Incidental Mutation 'R6257:Ccser1'
ID 506388
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 044374-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R6257 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61350946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 501 (D501G)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000067307] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably damaging
Transcript: ENSMUST00000045522
AA Change: D501G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: D501G

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067307
SMART Domains Protein: ENSMUSP00000067639
Gene: ENSMUSG00000039578

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
coiled coil region 162 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126214
AA Change: D501G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: D501G

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204337
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 36,272,074 (GRCm39) N313K probably benign Het
Adamts2 T C 11: 50,666,153 (GRCm39) V383A probably damaging Het
Adamts6 A T 13: 104,598,790 (GRCm39) Q877L probably benign Het
Adgre4 C T 17: 56,109,133 (GRCm39) T380I possibly damaging Het
Aspm A G 1: 139,409,791 (GRCm39) probably null Het
Atg16l2 A G 7: 100,951,102 (GRCm39) probably null Het
Bcl6b C T 11: 70,116,878 (GRCm39) R467H probably benign Het
Cacna2d4 G A 6: 119,258,580 (GRCm39) probably null Het
Casp8ap2 A G 4: 32,641,364 (GRCm39) D806G possibly damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cd164l2 T A 4: 132,948,345 (GRCm39) C19S unknown Het
Cdk15 G A 1: 59,296,264 (GRCm39) probably null Het
Cebpz T C 17: 79,243,261 (GRCm39) E131G probably benign Het
Ces1d T C 8: 93,893,025 (GRCm39) D519G probably benign Het
Cftr A C 6: 18,282,500 (GRCm39) T1067P probably benign Het
Chd1 T G 17: 15,950,465 (GRCm39) probably null Het
Chil4 T A 3: 106,111,412 (GRCm39) D234V possibly damaging Het
Cldn16 T A 16: 26,300,080 (GRCm39) S173T probably damaging Het
Cpd A T 11: 76,703,496 (GRCm39) F456I probably benign Het
Cst8 C A 2: 148,647,365 (GRCm39) A125E probably damaging Het
Dars2 G T 1: 160,869,398 (GRCm39) P617Q probably damaging Het
Defb26 A G 2: 152,349,860 (GRCm39) V140A unknown Het
Dntt T G 19: 41,041,501 (GRCm39) V395G probably damaging Het
Dock10 G A 1: 80,481,413 (GRCm39) probably benign Het
Dscam T C 16: 96,474,914 (GRCm39) N1216S possibly damaging Het
En1 A T 1: 120,531,636 (GRCm39) D292V unknown Het
Erbb4 A T 1: 68,435,432 (GRCm39) L155Q probably damaging Het
Erbin T C 13: 103,998,796 (GRCm39) T197A probably benign Het
Fat2 A G 11: 55,153,407 (GRCm39) F3602L probably benign Het
Fcsk A T 8: 111,617,177 (GRCm39) C365S probably benign Het
Gm3443 A T 19: 21,533,075 (GRCm39) D13V unknown Het
Gm6401 T C 14: 41,789,828 (GRCm39) Q10R probably benign Het
Gmcl1 G A 6: 86,677,623 (GRCm39) T410I possibly damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
H2-T24 T A 17: 36,325,574 (GRCm39) T305S probably benign Het
Ksr2 A T 5: 117,552,909 (GRCm39) M6L probably benign Het
Lama2 A G 10: 26,862,895 (GRCm39) L2956S possibly damaging Het
Lhfpl3 A G 5: 22,951,557 (GRCm39) T123A probably benign Het
Lrp1b T A 2: 40,486,981 (GRCm39) probably null Het
Ltn1 G A 16: 87,208,662 (GRCm39) A812V possibly damaging Het
Maml2 C T 9: 13,531,722 (GRCm39) S312L probably damaging Het
Myo7b T A 18: 32,146,468 (GRCm39) N106Y probably damaging Het
Nacc2 A T 2: 25,950,420 (GRCm39) C439S probably damaging Het
Ncoa7 A G 10: 30,570,173 (GRCm39) I224T probably damaging Het
Nf1 A T 11: 79,440,317 (GRCm39) L2303F probably damaging Het
Noc3l A T 19: 38,784,349 (GRCm39) probably null Het
Nup155 C T 15: 8,180,282 (GRCm39) R1120* probably null Het
Oas3 C A 5: 120,899,200 (GRCm39) probably benign Het
Ocln T C 13: 100,676,017 (GRCm39) I159V probably benign Het
Or1p1c T C 11: 74,160,833 (GRCm39) V206A probably damaging Het
Or2t45 T A 11: 58,669,829 (GRCm39) V292E probably damaging Het
Os9 A C 10: 126,955,006 (GRCm39) C181G probably damaging Het
Phldb1 C T 9: 44,607,437 (GRCm39) R1256Q probably damaging Het
Pkd1l1 G A 11: 8,892,195 (GRCm39) T208I probably benign Het
Plppr4 T C 3: 117,116,228 (GRCm39) Q485R possibly damaging Het
Prkcb T A 7: 122,167,386 (GRCm39) D365E probably benign Het
Ptprz1 T A 6: 22,959,639 (GRCm39) N45K probably damaging Het
Rbl2 T C 8: 91,842,306 (GRCm39) L987P probably damaging Het
Runx1 T A 16: 92,492,799 (GRCm39) probably benign Het
Septin4 C A 11: 87,481,175 (GRCm39) Q372K probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Smtnl2 G A 11: 72,292,225 (GRCm39) A274V probably damaging Het
Sri T A 5: 8,109,596 (GRCm39) probably null Het
St3gal3 C T 4: 117,964,875 (GRCm39) probably benign Het
Tfpt A T 7: 3,632,566 (GRCm39) L3* probably null Het
Tgfb3 T C 12: 86,124,615 (GRCm39) D31G possibly damaging Het
Thsd7a G T 6: 12,408,987 (GRCm39) C678* probably null Het
Tmbim1 A G 1: 74,332,225 (GRCm39) Y101H probably damaging Het
Tmem17 A G 11: 22,462,297 (GRCm39) probably benign Het
Tmprss15 A T 16: 78,769,113 (GRCm39) V769E probably damaging Het
Trak1 C T 9: 121,275,821 (GRCm39) R175C probably damaging Het
Trak1 G T 9: 121,196,290 (GRCm39) V41F possibly damaging Het
Trim30c T C 7: 104,039,375 (GRCm39) Y140C probably damaging Het
Tubgcp3 A T 8: 12,699,835 (GRCm39) probably null Het
Ubr7 T A 12: 102,732,099 (GRCm39) C158* probably null Het
Vmn2r79 A T 7: 86,651,778 (GRCm39) L392F probably benign Het
Zfp536 T A 7: 37,179,830 (GRCm39) D925V probably damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61,399,944 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R5970:Ccser1 UTSW 6 61,288,226 (GRCm39) missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7729:Ccser1 UTSW 6 61,288,840 (GRCm39) missense probably benign
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8055:Ccser1 UTSW 6 61,290,757 (GRCm39) missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8724:Ccser1 UTSW 6 61,288,199 (GRCm39) missense probably damaging 0.99
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATGGCAGTTAAAATAGGTGGGC -3'
(R):5'- TGTCTAGATTATTGTGAAAAGCTGCAC -3'

Sequencing Primer
(F):5'- TGTGAAAACAGGCATTTTTATTCTG -3'
(R):5'- TTGTGAAAAGCTGCACTTAAAGCG -3'
Posted On 2018-03-15