Incidental Mutation 'R6257:Trim30c'
ID506396
Institutional Source Beutler Lab
Gene Symbol Trim30c
Ensembl Gene ENSMUSG00000078616
Gene Nametripartite motif-containing 30C
SynonymsGm5598, Trim30-2
MMRRC Submission 044374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104382065-104400837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104390168 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 140 (Y140C)
Ref Sequence ENSEMBL: ENSMUSP00000102441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106828]
Predicted Effect probably damaging
Transcript: ENSMUST00000106828
AA Change: Y140C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102441
Gene: ENSMUSG00000078616
AA Change: Y140C

DomainStartEndE-ValueType
RING 16 59 2.51e-10 SMART
BBOX 92 133 2.02e-14 SMART
low complexity region 197 229 N/A INTRINSIC
Pfam:SPRY 356 495 1.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Trim30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim30c APN 7 104382182 nonsense probably null
IGL00573:Trim30c APN 7 104382631 missense possibly damaging 0.66
IGL01023:Trim30c APN 7 104382972 splice site probably benign
IGL01413:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL01418:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL02330:Trim30c APN 7 104382958 missense possibly damaging 0.61
IGL02389:Trim30c APN 7 104382174 missense probably benign 0.00
IGL03107:Trim30c APN 7 104382613 missense possibly damaging 0.95
R0195:Trim30c UTSW 7 104382429 missense probably benign
R0324:Trim30c UTSW 7 104383309 missense possibly damaging 0.79
R0826:Trim30c UTSW 7 104383481 missense probably benign 0.01
R0865:Trim30c UTSW 7 104390451 missense probably damaging 1.00
R1484:Trim30c UTSW 7 104383252 missense probably benign 0.00
R1513:Trim30c UTSW 7 104382689 missense probably benign 0.04
R1563:Trim30c UTSW 7 104382951 missense probably benign 0.00
R2220:Trim30c UTSW 7 104383267 missense probably benign
R2442:Trim30c UTSW 7 104382274 missense probably damaging 1.00
R5326:Trim30c UTSW 7 104388304 missense possibly damaging 0.89
R5777:Trim30c UTSW 7 104383331 missense probably benign 0.08
R6118:Trim30c UTSW 7 104382081 missense probably benign 0.01
R6374:Trim30c UTSW 7 104390402 missense probably benign 0.01
R7387:Trim30c UTSW 7 104390190 missense probably damaging 1.00
R7419:Trim30c UTSW 7 104388265 missense probably benign 0.11
R7500:Trim30c UTSW 7 104387551 missense probably benign 0.00
R7542:Trim30c UTSW 7 104382218 missense possibly damaging 0.95
Z1176:Trim30c UTSW 7 104383258 missense not run
Predicted Primers PCR Primer
(F):5'- TTTGGCTTTCTTGGACATCAAC -3'
(R):5'- GAGTTGAAGTCTATCCCAGAGG -3'

Sequencing Primer
(F):5'- GAAGCAGTTCCAAAATATTGTGTTG -3'
(R):5'- GAGAAGGAGAAAGTGTTTTACTGTGC -3'
Posted On2018-03-15