Incidental Mutation 'R6257:Olfr315'
ID506413
Institutional Source Beutler Lab
Gene Symbol Olfr315
Ensembl Gene ENSMUSG00000056959
Gene Nameolfactory receptor 315
SynonymsMOR278-1, GA_x6K02T2NKPP-630272-629343
MMRRC Submission 044374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58773188-58780251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58779003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 292 (V292E)
Ref Sequence ENSEMBL: ENSMUSP00000144944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081533] [ENSMUST00000203256] [ENSMUST00000205189]
Predicted Effect probably damaging
Transcript: ENSMUST00000081533
AA Change: V292E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080248
Gene: ENSMUSG00000056959
AA Change: V292E

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 3.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 34 252 1.3e-7 PFAM
Pfam:7tm_1 41 290 6.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203256
AA Change: V292E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144944
Gene: ENSMUSG00000056959
AA Change: V292E

DomainStartEndE-ValueType
Pfam:7tm_4 29 126 1.2e-13 PFAM
Pfam:7TM_GPCR_Srsx 35 126 1.8e-5 PFAM
Pfam:7tm_1 41 126 4.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205189
SMART Domains Protein: ENSMUSP00000145387
Gene: ENSMUSG00000059504

DomainStartEndE-ValueType
Pfam:7tm_4 26 259 8.9e-42 PFAM
Pfam:7TM_GPCR_Srsx 33 246 9.4e-6 PFAM
Pfam:7tm_1 39 259 1.1e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Olfr315
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Olfr315 APN 11 58778297 missense probably benign 0.21
IGL03265:Olfr315 APN 11 58778871 missense probably damaging 1.00
R0395:Olfr315 UTSW 11 58778369 missense probably benign 0.05
R1760:Olfr315 UTSW 11 58778369 missense possibly damaging 0.79
R1782:Olfr315 UTSW 11 58778805 missense probably damaging 1.00
R2330:Olfr315 UTSW 11 58778999 missense probably damaging 1.00
R3831:Olfr315 UTSW 11 58778745 unclassified probably null
R4898:Olfr315 UTSW 11 58778306 missense possibly damaging 0.60
R5227:Olfr315 UTSW 11 58778879 missense possibly damaging 0.70
R7253:Olfr315 UTSW 11 58778996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACATCTGCTGCATTCTGATG -3'
(R):5'- GGGCAAATTGATTTTCCAAACGC -3'

Sequencing Primer
(F):5'- GATGCTCCTGATCCCGCTG -3'
(R):5'- AGAATAGAAAATGTCAAAGGAGCATC -3'
Posted On2018-03-15