Incidental Mutation 'R6257:Sept4'
ID506419
Institutional Source Beutler Lab
Gene Symbol Sept4
Ensembl Gene ENSMUSG00000020486
Gene Nameseptin 4
Synonymscell division control-related protein 2b, ARTS, Pnutl2, septin H5, Bh5
MMRRC Submission 044374-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87568903-87590539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87590349 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 372 (Q372K)
Ref Sequence ENSEMBL: ENSMUSP00000060127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000119628] [ENSMUST00000122067] [ENSMUST00000123105] [ENSMUST00000133202] [ENSMUST00000146871]
Predicted Effect probably benign
Transcript: ENSMUST00000018544
AA Change: Q471K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: Q471K

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063156
AA Change: Q372K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: Q372K

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092802
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103179
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107960
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107961
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107962
AA Change: Q452K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: Q452K

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119628
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122067
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect probably benign
Transcript: ENSMUST00000123105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143950
Predicted Effect probably benign
Transcript: ENSMUST00000133202
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Sept4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Sept4 APN 11 87589773 missense probably damaging 1.00
IGL00963:Sept4 APN 11 87583373 missense possibly damaging 0.89
IGL03087:Sept4 APN 11 87585245 splice site probably benign
IGL03268:Sept4 APN 11 87589703 missense probably damaging 0.99
R0077:Sept4 UTSW 11 87581196 missense probably benign
R1729:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1730:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1739:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1762:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1783:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1784:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1785:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1957:Sept4 UTSW 11 87590367 missense probably benign 0.02
R2131:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2133:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2140:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2141:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2252:Sept4 UTSW 11 87589811 missense possibly damaging 0.75
R3696:Sept4 UTSW 11 87585234 missense possibly damaging 0.48
R4018:Sept4 UTSW 11 87585121 missense probably damaging 1.00
R4193:Sept4 UTSW 11 87583316 critical splice acceptor site probably null
R4196:Sept4 UTSW 11 87588772 missense probably damaging 0.96
R5012:Sept4 UTSW 11 87584404 missense possibly damaging 0.78
R5149:Sept4 UTSW 11 87589245 missense probably damaging 1.00
R5891:Sept4 UTSW 11 87588924 unclassified probably benign
R6090:Sept4 UTSW 11 87589517 missense possibly damaging 0.48
R6145:Sept4 UTSW 11 87585246 splice site probably null
R6704:Sept4 UTSW 11 87589030 missense probably damaging 1.00
R7064:Sept4 UTSW 11 87590367 missense probably benign 0.02
R7090:Sept4 UTSW 11 87584438 missense probably damaging 1.00
R7784:Sept4 UTSW 11 87579008 missense probably benign
R7790:Sept4 UTSW 11 87589239 missense probably damaging 1.00
R8320:Sept4 UTSW 11 87589734 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTGGGAAGTCCTCCGTTTG -3'
(R):5'- GACACCTGAAGCCACATATAGG -3'

Sequencing Primer
(F):5'- GGAAGTCCTCCGTTTGATAAGCC -3'
(R):5'- AGGTTAGTTTATTTCCTCTGAGTCTC -3'
Posted On2018-03-15