Incidental Mutation 'R6257:Dscam'
ID506432
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 044374-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96673714 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1216 (N1216S)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056102
AA Change: N1216S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: N1216S

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Cebpz T C 17: 78,935,832 E131G probably benign Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R7926:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7961:Dscam UTSW 16 96709421 intron probably null
R7992:Dscam UTSW 16 96643922 missense probably benign 0.01
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCTCTGCATGTGGAGAC -3'
(R):5'- TTCAGTTATGAGGACACACTGGG -3'

Sequencing Primer
(F):5'- CTCTGCATGTGGAGACAACATGAC -3'
(R):5'- TTATGAGGACACACTGGGATCCTG -3'
Posted On2018-03-15