Incidental Mutation 'R6257:Cebpz'
ID506436
Institutional Source Beutler Lab
Gene Symbol Cebpz
Ensembl Gene ENSMUSG00000024081
Gene NameCCAAT/enhancer binding protein zeta
SynonymsCebpa-rs1, Cbf, CBF2
MMRRC Submission 044374-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6257 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78919006-78937070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78935832 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000024885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024885] [ENSMUST00000024887]
Predicted Effect probably benign
Transcript: ENSMUST00000024885
AA Change: E131G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: E131G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
coiled coil region 113 143 N/A INTRINSIC
Pfam:CBF 523 732 5.7e-58 PFAM
low complexity region 834 851 N/A INTRINSIC
low complexity region 881 904 N/A INTRINSIC
low complexity region 957 969 N/A INTRINSIC
low complexity region 1028 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024887
SMART Domains Protein: ENSMUSP00000024887
Gene: ENSMUSG00000024082

DomainStartEndE-ValueType
Pfam:Methyltransf_28 95 349 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,961,182 N313K probably benign Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Adamts6 A T 13: 104,462,282 Q877L probably benign Het
Adgre4 C T 17: 55,802,133 T380I possibly damaging Het
Aspm A G 1: 139,482,053 probably null Het
Atg16l2 A G 7: 101,301,895 probably null Het
Bcl6b C T 11: 70,226,052 R467H probably benign Het
Cacna2d4 G A 6: 119,281,619 probably null Het
Casp8ap2 A G 4: 32,641,364 D806G possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Ccser1 A G 6: 61,373,962 D501G probably damaging Het
Ccser1 A G 6: 62,379,785 T736A probably benign Het
Cd164l2 T A 4: 133,221,034 C19S unknown Het
Cdk15 G A 1: 59,257,105 probably null Het
Ces1d T C 8: 93,166,397 D519G probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Chd1 T G 17: 15,730,203 probably null Het
Chil4 T A 3: 106,204,096 D234V possibly damaging Het
Cldn16 T A 16: 26,481,330 S173T probably damaging Het
Cpd A T 11: 76,812,670 F456I probably benign Het
Cst8 C A 2: 148,805,445 A125E probably damaging Het
Dars2 G T 1: 161,041,828 P617Q probably damaging Het
Defb26 A G 2: 152,507,940 V140A unknown Het
Dntt T G 19: 41,053,062 V395G probably damaging Het
Dock10 G A 1: 80,503,696 probably benign Het
Dscam T C 16: 96,673,714 N1216S possibly damaging Het
En1 A T 1: 120,603,907 D292V unknown Het
Erbb4 A T 1: 68,396,273 L155Q probably damaging Het
Erbin T C 13: 103,862,288 T197A probably benign Het
Fat2 A G 11: 55,262,581 F3602L probably benign Het
Fuk A T 8: 110,890,545 C365S probably benign Het
Gm3443 A T 19: 21,555,711 D13V unknown Het
Gm6401 T C 14: 41,967,871 Q10R probably benign Het
Gmcl1 G A 6: 86,700,641 T410I possibly damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H2-T24 T A 17: 36,014,682 T305S probably benign Het
Ksr2 A T 5: 117,414,844 M6L probably benign Het
Lama2 A G 10: 26,986,899 L2956S possibly damaging Het
Lhfpl3 A G 5: 22,746,559 T123A probably benign Het
Lrp1b T A 2: 40,596,969 probably null Het
Ltn1 G A 16: 87,411,774 A812V possibly damaging Het
Maml2 C T 9: 13,620,426 S312L probably damaging Het
Myo7b T A 18: 32,013,415 N106Y probably damaging Het
Nacc2 A T 2: 26,060,408 C439S probably damaging Het
Ncoa7 A G 10: 30,694,177 I224T probably damaging Het
Nf1 A T 11: 79,549,491 L2303F probably damaging Het
Noc3l A T 19: 38,795,905 probably null Het
Nup155 C T 15: 8,150,798 R1120* probably null Het
Oas3 C A 5: 120,761,135 probably benign Het
Ocln T C 13: 100,539,509 I159V probably benign Het
Olfr315 T A 11: 58,779,003 V292E probably damaging Het
Olfr406 T C 11: 74,270,007 V206A probably damaging Het
Os9 A C 10: 127,119,137 C181G probably damaging Het
Phldb1 C T 9: 44,696,140 R1256Q probably damaging Het
Pkd1l1 G A 11: 8,942,195 T208I probably benign Het
Plppr4 T C 3: 117,322,579 Q485R possibly damaging Het
Prkcb T A 7: 122,568,163 D365E probably benign Het
Ptprz1 T A 6: 22,959,640 N45K probably damaging Het
Rbl2 T C 8: 91,115,678 L987P probably damaging Het
Runx1 T A 16: 92,695,911 probably benign Het
Sept4 C A 11: 87,590,349 Q372K probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Sri T A 5: 8,059,596 probably null Het
St3gal3 C T 4: 118,107,678 probably benign Het
Tfpt A T 7: 3,629,567 L3* probably null Het
Tgfb3 T C 12: 86,077,841 D31G possibly damaging Het
Thsd7a G T 6: 12,408,988 C678* probably null Het
Tmbim1 A G 1: 74,293,066 Y101H probably damaging Het
Tmem17 A G 11: 22,512,297 probably benign Het
Tmprss15 A T 16: 78,972,225 V769E probably damaging Het
Trak1 C T 9: 121,446,755 R175C probably damaging Het
Trak1 G T 9: 121,367,224 V41F possibly damaging Het
Trim30c T C 7: 104,390,168 Y140C probably damaging Het
Tubgcp3 A T 8: 12,649,835 probably null Het
Ubr7 T A 12: 102,765,840 C158* probably null Het
Vmn2r79 A T 7: 87,002,570 L392F probably benign Het
Zfp536 T A 7: 37,480,405 D925V probably damaging Het
Other mutations in Cebpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Cebpz APN 17 78934830 missense probably damaging 1.00
IGL01558:Cebpz APN 17 78935305 missense probably damaging 1.00
IGL01724:Cebpz APN 17 78935913 missense probably benign 0.01
IGL01938:Cebpz APN 17 78934961 nonsense probably null
IGL02165:Cebpz APN 17 78922169 missense probably damaging 1.00
IGL02397:Cebpz APN 17 78923261 missense possibly damaging 0.63
IGL02455:Cebpz APN 17 78935036 missense probably benign 0.16
IGL02690:Cebpz APN 17 78922557 missense probably damaging 1.00
IGL02698:Cebpz APN 17 78935574 missense probably benign 0.03
IGL02755:Cebpz APN 17 78931330 missense probably damaging 1.00
IGL02827:Cebpz APN 17 78929331 missense probably damaging 1.00
IGL03149:Cebpz APN 17 78922553 missense probably benign 0.01
cedar_hill UTSW 17 78936910 missense possibly damaging 0.87
R0125:Cebpz UTSW 17 78919888 missense possibly damaging 0.95
R0138:Cebpz UTSW 17 78931391 missense probably benign
R0310:Cebpz UTSW 17 78926124 missense probably damaging 1.00
R0436:Cebpz UTSW 17 78935650 missense probably benign 0.00
R0589:Cebpz UTSW 17 78936879 missense probably damaging 1.00
R0828:Cebpz UTSW 17 78925982 missense probably benign 0.04
R1355:Cebpz UTSW 17 78935324 missense probably benign 0.01
R1367:Cebpz UTSW 17 78923313 missense probably benign
R1583:Cebpz UTSW 17 78934752 missense probably damaging 1.00
R1639:Cebpz UTSW 17 78934606 missense possibly damaging 0.49
R1818:Cebpz UTSW 17 78935376 missense probably damaging 1.00
R1885:Cebpz UTSW 17 78932116 missense probably benign 0.00
R1908:Cebpz UTSW 17 78934907 nonsense probably null
R1909:Cebpz UTSW 17 78934907 nonsense probably null
R2094:Cebpz UTSW 17 78935554 missense probably benign 0.03
R2314:Cebpz UTSW 17 78920547 critical splice donor site probably null
R2763:Cebpz UTSW 17 78935929 missense probably benign
R2874:Cebpz UTSW 17 78932103 splice site probably benign
R3807:Cebpz UTSW 17 78935418 missense probably damaging 1.00
R4012:Cebpz UTSW 17 78924467 missense probably damaging 0.98
R5344:Cebpz UTSW 17 78926113 missense possibly damaging 0.82
R5394:Cebpz UTSW 17 78922205 missense probably benign 0.34
R5711:Cebpz UTSW 17 78934611 missense probably damaging 1.00
R5902:Cebpz UTSW 17 78925937 missense probably benign 0.20
R6238:Cebpz UTSW 17 78936910 missense possibly damaging 0.87
R6825:Cebpz UTSW 17 78919963 missense probably damaging 1.00
R7735:Cebpz UTSW 17 78925913 critical splice donor site probably null
R8045:Cebpz UTSW 17 78932156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGCTTTGTACTTGGACACGAC -3'
(R):5'- GGAACCATTGACGACCTTCAAC -3'

Sequencing Primer
(F):5'- GTACTTGGACACGACATCTGG -3'
(R):5'- CCTTCAACAAGGTGAACTGGAGTC -3'
Posted On2018-03-15