Incidental Mutation 'R6257:Myo7b'
ID 506437
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 044374-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6257 (G1)
Quality Score 97.0078
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32146468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 106 (N106Y)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: N106Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: N106Y

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 36,272,074 (GRCm39) N313K probably benign Het
Adamts2 T C 11: 50,666,153 (GRCm39) V383A probably damaging Het
Adamts6 A T 13: 104,598,790 (GRCm39) Q877L probably benign Het
Adgre4 C T 17: 56,109,133 (GRCm39) T380I possibly damaging Het
Aspm A G 1: 139,409,791 (GRCm39) probably null Het
Atg16l2 A G 7: 100,951,102 (GRCm39) probably null Het
Bcl6b C T 11: 70,116,878 (GRCm39) R467H probably benign Het
Cacna2d4 G A 6: 119,258,580 (GRCm39) probably null Het
Casp8ap2 A G 4: 32,641,364 (GRCm39) D806G possibly damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Ccser1 A G 6: 61,350,946 (GRCm39) D501G probably damaging Het
Ccser1 A G 6: 62,356,769 (GRCm39) T736A probably benign Het
Cd164l2 T A 4: 132,948,345 (GRCm39) C19S unknown Het
Cdk15 G A 1: 59,296,264 (GRCm39) probably null Het
Cebpz T C 17: 79,243,261 (GRCm39) E131G probably benign Het
Ces1d T C 8: 93,893,025 (GRCm39) D519G probably benign Het
Cftr A C 6: 18,282,500 (GRCm39) T1067P probably benign Het
Chd1 T G 17: 15,950,465 (GRCm39) probably null Het
Chil4 T A 3: 106,111,412 (GRCm39) D234V possibly damaging Het
Cldn16 T A 16: 26,300,080 (GRCm39) S173T probably damaging Het
Cpd A T 11: 76,703,496 (GRCm39) F456I probably benign Het
Cst8 C A 2: 148,647,365 (GRCm39) A125E probably damaging Het
Dars2 G T 1: 160,869,398 (GRCm39) P617Q probably damaging Het
Defb26 A G 2: 152,349,860 (GRCm39) V140A unknown Het
Dntt T G 19: 41,041,501 (GRCm39) V395G probably damaging Het
Dock10 G A 1: 80,481,413 (GRCm39) probably benign Het
Dscam T C 16: 96,474,914 (GRCm39) N1216S possibly damaging Het
En1 A T 1: 120,531,636 (GRCm39) D292V unknown Het
Erbb4 A T 1: 68,435,432 (GRCm39) L155Q probably damaging Het
Erbin T C 13: 103,998,796 (GRCm39) T197A probably benign Het
Fat2 A G 11: 55,153,407 (GRCm39) F3602L probably benign Het
Fcsk A T 8: 111,617,177 (GRCm39) C365S probably benign Het
Gm3443 A T 19: 21,533,075 (GRCm39) D13V unknown Het
Gm6401 T C 14: 41,789,828 (GRCm39) Q10R probably benign Het
Gmcl1 G A 6: 86,677,623 (GRCm39) T410I possibly damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
H2-T24 T A 17: 36,325,574 (GRCm39) T305S probably benign Het
Ksr2 A T 5: 117,552,909 (GRCm39) M6L probably benign Het
Lama2 A G 10: 26,862,895 (GRCm39) L2956S possibly damaging Het
Lhfpl3 A G 5: 22,951,557 (GRCm39) T123A probably benign Het
Lrp1b T A 2: 40,486,981 (GRCm39) probably null Het
Ltn1 G A 16: 87,208,662 (GRCm39) A812V possibly damaging Het
Maml2 C T 9: 13,531,722 (GRCm39) S312L probably damaging Het
Nacc2 A T 2: 25,950,420 (GRCm39) C439S probably damaging Het
Ncoa7 A G 10: 30,570,173 (GRCm39) I224T probably damaging Het
Nf1 A T 11: 79,440,317 (GRCm39) L2303F probably damaging Het
Noc3l A T 19: 38,784,349 (GRCm39) probably null Het
Nup155 C T 15: 8,180,282 (GRCm39) R1120* probably null Het
Oas3 C A 5: 120,899,200 (GRCm39) probably benign Het
Ocln T C 13: 100,676,017 (GRCm39) I159V probably benign Het
Or1p1c T C 11: 74,160,833 (GRCm39) V206A probably damaging Het
Or2t45 T A 11: 58,669,829 (GRCm39) V292E probably damaging Het
Os9 A C 10: 126,955,006 (GRCm39) C181G probably damaging Het
Phldb1 C T 9: 44,607,437 (GRCm39) R1256Q probably damaging Het
Pkd1l1 G A 11: 8,892,195 (GRCm39) T208I probably benign Het
Plppr4 T C 3: 117,116,228 (GRCm39) Q485R possibly damaging Het
Prkcb T A 7: 122,167,386 (GRCm39) D365E probably benign Het
Ptprz1 T A 6: 22,959,639 (GRCm39) N45K probably damaging Het
Rbl2 T C 8: 91,842,306 (GRCm39) L987P probably damaging Het
Runx1 T A 16: 92,492,799 (GRCm39) probably benign Het
Septin4 C A 11: 87,481,175 (GRCm39) Q372K probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Smtnl2 G A 11: 72,292,225 (GRCm39) A274V probably damaging Het
Sri T A 5: 8,109,596 (GRCm39) probably null Het
St3gal3 C T 4: 117,964,875 (GRCm39) probably benign Het
Tfpt A T 7: 3,632,566 (GRCm39) L3* probably null Het
Tgfb3 T C 12: 86,124,615 (GRCm39) D31G possibly damaging Het
Thsd7a G T 6: 12,408,987 (GRCm39) C678* probably null Het
Tmbim1 A G 1: 74,332,225 (GRCm39) Y101H probably damaging Het
Tmem17 A G 11: 22,462,297 (GRCm39) probably benign Het
Tmprss15 A T 16: 78,769,113 (GRCm39) V769E probably damaging Het
Trak1 C T 9: 121,275,821 (GRCm39) R175C probably damaging Het
Trak1 G T 9: 121,196,290 (GRCm39) V41F possibly damaging Het
Trim30c T C 7: 104,039,375 (GRCm39) Y140C probably damaging Het
Tubgcp3 A T 8: 12,699,835 (GRCm39) probably null Het
Ubr7 T A 12: 102,732,099 (GRCm39) C158* probably null Het
Vmn2r79 A T 7: 86,651,778 (GRCm39) L392F probably benign Het
Zfp536 T A 7: 37,179,830 (GRCm39) D925V probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGGGGCTTAAAGGCAGTAG -3'
(R):5'- CGGAAACTCGTGGTTCTAGAG -3'

Sequencing Primer
(F):5'- CTTAAAGGCAGTAGCTGACCATCTG -3'
(R):5'- GGATGCTCCATCTTCTCAGAGGAAG -3'
Posted On 2018-03-15