Incidental Mutation 'R6258:Ctsa'
ID506455
Institutional Source Beutler Lab
Gene Symbol Ctsa
Ensembl Gene ENSMUSG00000017760
Gene Namecathepsin A
SynonymsPpgb, PPCA
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164832873-164841032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164834361 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000123413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017904] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493] [ENSMUST00000152721]
Predicted Effect probably damaging
Transcript: ENSMUST00000017904
AA Change: V92A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017904
Gene: ENSMUSG00000017760
AA Change: V92A

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Peptidase_S10 52 489 2.5e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042775
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103092
AA Change: V92A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760
AA Change: V92A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103093
AA Change: V74A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760
AA Change: V74A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127650
AA Change: V74A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760
AA Change: V74A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably damaging
Transcript: ENSMUST00000143780
AA Change: V86A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760
AA Change: V86A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Meta Mutation Damage Score 0.9022 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein with deamidase, esterase and carboxypeptidase activities. The encoded protein associates with and provides a protective function to the lysosomal enzymes beta-galactosidase and neuraminidase. Deficiency of the related gene in humans results in galactosialidosis. The proprotein is processed into two shorter chains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutants show aberrant lysosomal storage, with vacuolization in specific cells of most tissues. An abormally flat face and reduced body size are apparent at birth, and health progressively deteriorates, with accompanying generalized edema, ataxia and tremors. Death occurs at ~12 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Egflam T A 15: 7,234,292 T726S probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Ctsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Ctsa APN 2 164834310 unclassified probably benign
IGL02489:Ctsa APN 2 164838645 missense probably damaging 0.96
IGL02522:Ctsa APN 2 164839141 unclassified probably benign
IGL03008:Ctsa APN 2 164837448 missense probably damaging 1.00
R2058:Ctsa UTSW 2 164834902 missense probably null 0.00
R2402:Ctsa UTSW 2 164834893 missense probably benign 0.36
R3123:Ctsa UTSW 2 164835232 unclassified probably null
R4270:Ctsa UTSW 2 164835302 missense probably benign 0.00
R4588:Ctsa UTSW 2 164834150 missense possibly damaging 0.62
R5236:Ctsa UTSW 2 164838911 missense probably damaging 1.00
R5331:Ctsa UTSW 2 164834309 unclassified probably benign
R6260:Ctsa UTSW 2 164834361 missense probably damaging 1.00
R6853:Ctsa UTSW 2 164837364 missense probably benign 0.00
R7654:Ctsa UTSW 2 164838933 missense probably benign 0.38
R7822:Ctsa UTSW 2 164839232 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTCCGGCAATACTCCGG -3'
(R):5'- TGTTAAGGAAAGCAAACTTAGGCC -3'

Sequencing Primer
(F):5'- TACTCCGGCTACCTCAGAG -3'
(R):5'- AAACTTAGGCCACAGGTTCCTTC -3'
Posted On2018-03-15