Mutagenetix > Incidental Mutations

Incidental Mutation 'R6258:Map2k5'

506481

Institutional Source

Beutler Lab

Gene Symbol

Map2k5

Ensembl Gene

ENSMUSG00000058444

Gene Name

mitogen-activated protein kinase kinase 5

Synonyms

MEK5

MMRRC Submission

044375-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6258 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63163768-63377902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63217365 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 359 (I359F)

Ref Sequence

ENSEMBL: ENSMUSP00000034920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034920]

PDB Structure

Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000034920
AA Change: I359F

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: I359F

Domain	Start	End	E-Value	Type
PB1	18	97	7.59e-12	SMART
S_TKc	166	419	7.75e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213604

Meta Mutation Damage Score

0.1221

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	T	C	5: 109,676,567	H339R	probably benign	Het
Adamtsl3	T	C	7: 82,528,983		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
AU041133	A	G	10: 82,151,158	E215G	probably damaging	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Casr	A	G	16: 36,517,609	C60R	probably damaging	Het
Cdc7	A	G	5: 106,969,227	K84E	probably damaging	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Clcc1	G	A	3: 108,673,308	V313I	possibly damaging	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Cyp2s1	ACAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAG	7: 25,816,442		probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Egflam	T	A	15: 7,234,292	T726S	probably damaging	Het
Eml2	T	G	7: 19,179,364		probably null	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Faiml	T	C	9: 99,232,460	I125M	possibly damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Fbxw2	A	T	2: 34,812,813		probably null	Het
Fgd6	T	A	10: 94,044,299	N338K	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm32742	T	A	9: 51,157,562	I200F	probably damaging	Het
Gm35339	C	A	15: 76,355,695	S277*	probably null	Het
Gm4924	T	G	10: 82,377,473		probably benign	Het
Gm8369	G	A	19: 11,511,609	A87T	possibly damaging	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Ighv5-8	A	G	12: 113,654,991	T9A	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jakmip1	G	T	5: 37,141,760	E775*	probably null	Het
Klhl40	T	C	9: 121,777,960	F62S	probably damaging	Het
Krtcap3	A	T	5: 31,252,228	R84W	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	T	C	7: 66,710,748		probably null	Het
Magi3	A	G	3: 104,089,596	L211P	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mef2c	T	A	13: 83,652,938	D252E	probably damaging	Het
Methig1	T	C	15: 100,353,541	V111A	possibly damaging	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Nf1	A	T	11: 79,565,755		probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr485	T	C	7: 108,158,974	N300D	probably damaging	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pde7b	T	C	10: 20,440,800	D168G	possibly damaging	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rptn	C	G	3: 93,398,130	H923Q	possibly damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Samm50	C	G	15: 84,200,311	P150A	probably damaging	Het
Samm50	C	A	15: 84,200,312	P150H	probably damaging	Het
Slc6a18	A	T	13: 73,670,045	C284*	probably null	Het
Smc3	T	A	19: 53,627,731		probably null	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
Sucnr1	T	C	3: 60,086,357	L102P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,516	W76R	probably damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ubr3	A	G	2: 69,982,864		probably null	Het
Ung	A	T	5: 114,137,300	Y250F	probably benign	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het
Zscan4-ps1	C	A	7: 11,065,902	E353D	probably benign	Het

Other mutations in Map2k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Map2k5	APN	9	63281077	splice site	probably benign
IGL01412:Map2k5	APN	9	63293706	missense	probably damaging	1.00
IGL01766:Map2k5	APN	9	63377227	missense	probably benign
IGL02246:Map2k5	APN	9	63377129	missense	probably benign	0.10
IGL02270:Map2k5	APN	9	63322197	splice site	probably null
IGL02793:Map2k5	APN	9	63257039	missense	probably benign	0.32
IGL03236:Map2k5	APN	9	63286392	splice site	probably benign
R0007:Map2k5	UTSW	9	63293724	missense	probably damaging	1.00
R0217:Map2k5	UTSW	9	63256975	critical splice donor site	probably null
R0315:Map2k5	UTSW	9	63303151	missense	probably damaging	1.00
R0801:Map2k5	UTSW	9	63357979	splice site	probably benign
R1122:Map2k5	UTSW	9	63263163	missense	probably damaging	1.00
R1822:Map2k5	UTSW	9	63235303	missense	possibly damaging	0.79
R4308:Map2k5	UTSW	9	63235304	missense	probably benign	0.02
R4421:Map2k5	UTSW	9	63164130	missense	probably damaging	0.96
R4720:Map2k5	UTSW	9	63293719	missense	probably damaging	1.00
R4869:Map2k5	UTSW	9	63322243	nonsense	probably null
R5059:Map2k5	UTSW	9	63257014	missense	probably benign	0.41
R5138:Map2k5	UTSW	9	63263158	missense	probably damaging	0.99
R6005:Map2k5	UTSW	9	63281019	missense	probably damaging	1.00
R6261:Map2k5	UTSW	9	63338098	missense	probably benign	0.00
R6498:Map2k5	UTSW	9	63286401	missense	possibly damaging	0.74
R6808:Map2k5	UTSW	9	63322246	missense	probably benign	0.00
R7228:Map2k5	UTSW	9	63358022	missense	probably damaging	1.00
R7819:Map2k5	UTSW	9	63358018	missense	probably damaging	0.99
R8017:Map2k5	UTSW	9	63339121	missense	probably damaging	0.98
R8053:Map2k5	UTSW	9	63343425	missense	probably benign	0.16
R8247:Map2k5	UTSW	9	63371737	missense	probably damaging	1.00
R8309:Map2k5	UTSW	9	63339079	critical splice donor site	probably null
R8341:Map2k5	UTSW	9	63339098	missense	probably damaging	1.00
Z1176:Map2k5	UTSW	9	63358038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACATGGATGCTCAGGACGTC -3'
(R):5'- GAAATTAACATTCTGCTGACTTTCGCC -3'

Sequencing Primer
(F):5'- GGATGCTCAGGACGTCCTATTATTTC -3'
(R):5'- CTTTCGCCTATAAATGAGAAGCGAGC -3'

Posted On

2018-03-15