Incidental Mutation 'R6258:Egflam'
ID506502
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene NameEGF-like, fibronectin type III and laminin G domains
Synonymsnectican, pikachurin
MMRRC Submission 044375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6258 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7206120-7398395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7234292 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 726 (T726S)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
Predicted Effect probably damaging
Transcript: ENSMUST00000058593
AA Change: T726S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961
AA Change: T726S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096494
AA Change: T726S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: T726S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,676,567 H339R probably benign Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
AU041133 A G 10: 82,151,158 E215G probably damaging Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Casr A G 16: 36,517,609 C60R probably damaging Het
Cdc7 A G 5: 106,969,227 K84E probably damaging Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Clcc1 G A 3: 108,673,308 V313I possibly damaging Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Eml2 T G 7: 19,179,364 probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Faiml T C 9: 99,232,460 I125M possibly damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Fbxw2 A T 2: 34,812,813 probably null Het
Fgd6 T A 10: 94,044,299 N338K probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm32742 T A 9: 51,157,562 I200F probably damaging Het
Gm35339 C A 15: 76,355,695 S277* probably null Het
Gm4924 T G 10: 82,377,473 probably benign Het
Gm8369 G A 19: 11,511,609 A87T possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Ighv5-8 A G 12: 113,654,991 T9A possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jakmip1 G T 5: 37,141,760 E775* probably null Het
Klhl40 T C 9: 121,777,960 F62S probably damaging Het
Krtcap3 A T 5: 31,252,228 R84W probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 T C 7: 66,710,748 probably null Het
Magi3 A G 3: 104,089,596 L211P probably damaging Het
Map2k5 T A 9: 63,217,365 I359F probably benign Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mef2c T A 13: 83,652,938 D252E probably damaging Het
Methig1 T C 15: 100,353,541 V111A possibly damaging Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Nf1 A T 11: 79,565,755 probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr485 T C 7: 108,158,974 N300D probably damaging Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pde7b T C 10: 20,440,800 D168G possibly damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Samm50 C G 15: 84,200,311 P150A probably damaging Het
Samm50 C A 15: 84,200,312 P150H probably damaging Het
Slc6a18 A T 13: 73,670,045 C284* probably null Het
Smc3 T A 19: 53,627,731 probably null Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
Sucnr1 T C 3: 60,086,357 L102P probably damaging Het
Tbc1d9 T C 8: 83,210,516 W76R probably damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ubr3 A G 2: 69,982,864 probably null Het
Ung A T 5: 114,137,300 Y250F probably benign Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zscan4-ps1 C A 7: 11,065,902 E353D probably benign Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7219764 missense probably damaging 1.00
IGL02352:Egflam APN 15 7234225 missense probably benign 0.01
IGL02359:Egflam APN 15 7234225 missense probably benign 0.01
IGL02389:Egflam APN 15 7250078 missense probably benign 0.01
IGL02400:Egflam APN 15 7247053 missense probably benign 0.00
IGL02530:Egflam APN 15 7222812 missense probably damaging 1.00
IGL02892:Egflam APN 15 7289796 missense probably benign
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0345:Egflam UTSW 15 7289994 intron probably null
R0504:Egflam UTSW 15 7222758 missense probably damaging 1.00
R0532:Egflam UTSW 15 7234237 missense probably benign 0.19
R0573:Egflam UTSW 15 7242425 nonsense probably null
R0609:Egflam UTSW 15 7253523 missense possibly damaging 0.65
R0648:Egflam UTSW 15 7207709 missense probably damaging 1.00
R0653:Egflam UTSW 15 7250028 critical splice donor site probably null
R1099:Egflam UTSW 15 7252422 missense probably benign 0.00
R1711:Egflam UTSW 15 7289915 missense possibly damaging 0.85
R1842:Egflam UTSW 15 7303941 missense probably benign 0.00
R1964:Egflam UTSW 15 7247105 missense probably damaging 0.97
R2001:Egflam UTSW 15 7242567 missense probably benign 0.18
R2008:Egflam UTSW 15 7237804 missense possibly damaging 0.95
R2134:Egflam UTSW 15 7234279 missense probably damaging 0.97
R2852:Egflam UTSW 15 7219701 missense probably damaging 1.00
R2853:Egflam UTSW 15 7219701 missense probably damaging 1.00
R4257:Egflam UTSW 15 7254426 splice site probably null
R4346:Egflam UTSW 15 7234278 nonsense probably null
R4380:Egflam UTSW 15 7243869 missense possibly damaging 0.70
R4538:Egflam UTSW 15 7252437 missense probably damaging 1.00
R4746:Egflam UTSW 15 7224639 splice site probably null
R4909:Egflam UTSW 15 7219629 missense probably damaging 1.00
R5027:Egflam UTSW 15 7253644 missense probably benign 0.00
R5314:Egflam UTSW 15 7304012 missense probably damaging 1.00
R5439:Egflam UTSW 15 7224663 missense probably damaging 0.99
R5495:Egflam UTSW 15 7251241 missense probably damaging 1.00
R5626:Egflam UTSW 15 7251207 missense possibly damaging 0.89
R5931:Egflam UTSW 15 7243857 missense possibly damaging 0.49
R5977:Egflam UTSW 15 7318245 missense possibly damaging 0.94
R6395:Egflam UTSW 15 7231695 missense probably damaging 1.00
R6497:Egflam UTSW 15 7251303 splice site probably null
R6736:Egflam UTSW 15 7219725 missense probably damaging 1.00
R7586:Egflam UTSW 15 7208601 missense probably damaging 1.00
R7764:Egflam UTSW 15 7318255 missense probably damaging 0.98
R7781:Egflam UTSW 15 7253746 missense probably null 0.94
R7842:Egflam UTSW 15 7251194 missense probably null 1.00
R7925:Egflam UTSW 15 7251194 missense probably null 1.00
R8011:Egflam UTSW 15 7247044 missense possibly damaging 0.89
X0024:Egflam UTSW 15 7304013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAGGAACAGGTGTTTGG -3'
(R):5'- AGTGATGTAGTCTGCACACAC -3'

Sequencing Primer
(F):5'- CAGGTGTTTGGAGAACTAGACTG -3'
(R):5'- GTGATGTAGTCTGCACACACATTCAG -3'
Posted On2018-03-15