Mutagenetix > Incidental Mutation

Incidental Mutation 'R6258:Pdzrn4'

506506

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

044375-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R6258 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92757681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 485 (E485V)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035399
AA Change: E246V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E246V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: E485V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E485V

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.1919

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	T	C	5: 109,676,567	H339R	probably benign	Het
Adamtsl3	T	C	7: 82,528,983		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
AU041133	A	G	10: 82,151,158	E215G	probably damaging	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Casr	A	G	16: 36,517,609	C60R	probably damaging	Het
Cdc7	A	G	5: 106,969,227	K84E	probably damaging	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Clcc1	G	A	3: 108,673,308	V313I	possibly damaging	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Cyp2s1	ACAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAG	7: 25,816,442		probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Egflam	T	A	15: 7,234,292	T726S	probably damaging	Het
Eml2	T	G	7: 19,179,364		probably null	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Faiml	T	C	9: 99,232,460	I125M	possibly damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Fbxw2	A	T	2: 34,812,813		probably null	Het
Fgd6	T	A	10: 94,044,299	N338K	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm32742	T	A	9: 51,157,562	I200F	probably damaging	Het
Gm35339	C	A	15: 76,355,695	S277*	probably null	Het
Gm4924	T	G	10: 82,377,473		probably benign	Het
Gm8369	G	A	19: 11,511,609	A87T	possibly damaging	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Ighv5-8	A	G	12: 113,654,991	T9A	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jakmip1	G	T	5: 37,141,760	E775*	probably null	Het
Klhl40	T	C	9: 121,777,960	F62S	probably damaging	Het
Krtcap3	A	T	5: 31,252,228	R84W	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lins1	T	C	7: 66,710,748		probably null	Het
Magi3	A	G	3: 104,089,596	L211P	probably damaging	Het
Map2k5	T	A	9: 63,217,365	I359F	probably benign	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mef2c	T	A	13: 83,652,938	D252E	probably damaging	Het
Methig1	T	C	15: 100,353,541	V111A	possibly damaging	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Nf1	A	T	11: 79,565,755		probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr485	T	C	7: 108,158,974	N300D	probably damaging	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pde7b	T	C	10: 20,440,800	D168G	possibly damaging	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rptn	C	G	3: 93,398,130	H923Q	possibly damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Samm50	C	G	15: 84,200,311	P150A	probably damaging	Het
Samm50	C	A	15: 84,200,312	P150H	probably damaging	Het
Slc6a18	A	T	13: 73,670,045	C284*	probably null	Het
Smc3	T	A	19: 53,627,731		probably null	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
Sucnr1	T	C	3: 60,086,357	L102P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,516	W76R	probably damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ubr3	A	G	2: 69,982,864		probably null	Het
Ung	A	T	5: 114,137,300	Y250F	probably benign	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het
Zscan4-ps1	C	A	7: 11,065,902	E353D	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGTTTCAGGAGAGGATAAAAGGCC -3'
(R):5'- TGAGAAGATCGTTTGCCCCG -3'

Sequencing Primer
(F):5'- CTTCTTTCTGAGAGGTGACCAGAG -3'
(R):5'- CGTTTGCCCCGAAAGATTATG -3'

Posted On

2018-03-15