Incidental Mutation 'R6259:Snrnp200'
ID506528
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127218423 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 529 (G529D)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103220
AA Change: G529D

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: G529D

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142327
Meta Mutation Damage Score 0.2768 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R7916:Snrnp200 UTSW 2 127233059 missense possibly damaging 0.51
R8117:Snrnp200 UTSW 2 127229131 missense probably benign
R8262:Snrnp200 UTSW 2 127227008 missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTCTGTGATGGACAACCC -3'
(R):5'- GGGTCAAATTCTACCTTGGAAATG -3'

Sequencing Primer
(F):5'- GAAGAGGCTTTGTCTCTG -3'
(R):5'- TAGAGTTTCCCTAACAAAAGAAGCAG -3'
Posted On2018-03-15