Incidental Mutation 'R6259:Atp11b'
ID506530
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35806901 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: Y379C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: Y379C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196965
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: Y179C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199892
AA Change: Y236C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Meta Mutation Damage Score 0.2431 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7614:Atp11b UTSW 3 35810110 splice site probably null
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7910:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R7991:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R8085:Atp11b UTSW 3 35841036 missense probably benign
R8095:Atp11b UTSW 3 35834416 missense probably damaging 1.00
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCTCAGGATATGGTTGATGGT -3'
(R):5'- ACCTAAAGTGGAAATGGTCAGGA -3'

Sequencing Primer
(F):5'- GGTTGATGGTGATTTATTTAAACAGG -3'
(R):5'- GTGGAAATGGTCAGGATATAAAGTG -3'
Posted On2018-03-15