Incidental Mutation 'R6259:Ngf'
ID506534
Institutional Source Beutler Lab
Gene Symbol Ngf
Ensembl Gene ENSMUSG00000027859
Gene Namenerve growth factor
SynonymsNgfb
MMRRC Submission 044376-MU
Accession Numbers

Ncbi RefSeq: NM_013609.2, NM_001112698.1; MGI:97321

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6259 (G1)
Quality Score214.009
Status Validated
Chromosome3
Chromosomal Location102469919-102521013 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 102509797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035952] [ENSMUST00000106925] [ENSMUST00000198168] [ENSMUST00000198644]
Predicted Effect probably benign
Transcript: ENSMUST00000035952
SMART Domains Protein: ENSMUSP00000040345
Gene: ENSMUSG00000027859

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 128 232 1.41e-78 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106925
AA Change: K8E
SMART Domains Protein: ENSMUSP00000102538
Gene: ENSMUSG00000027859
AA Change: K8E

DomainStartEndE-ValueType
NGF 194 298 1.41e-78 SMART
Predicted Effect unknown
Transcript: ENSMUST00000198168
AA Change: K8E
Predicted Effect probably benign
Transcript: ENSMUST00000198644
SMART Domains Protein: ENSMUSP00000142801
Gene: ENSMUSG00000027859

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NGF 190 294 7.1e-81 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype Strain: 1857535
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit elevated pain threshold, loss of neurons in both sensory and sympathetic ganglia, but diminished apoptosis in the retina and spinal cord. Heterozygotes exhibit a substantially reduced number of sympathetic neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Ngf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Ngf APN 3 102520472 missense probably damaging 0.99
IGL01344:Ngf APN 3 102520312 missense probably benign 0.00
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0147:Ngf UTSW 3 102509803 intron probably benign
R0148:Ngf UTSW 3 102509803 intron probably benign
R0149:Ngf UTSW 3 102520446 missense probably benign 0.13
R1769:Ngf UTSW 3 102520197 missense possibly damaging 0.87
R4357:Ngf UTSW 3 102520205 missense probably benign 0.22
R4486:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4487:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4488:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4817:Ngf UTSW 3 102509840 intron probably benign
R4883:Ngf UTSW 3 102520645 missense probably damaging 1.00
R4938:Ngf UTSW 3 102520474 missense probably damaging 1.00
R5158:Ngf UTSW 3 102520129 missense possibly damaging 0.82
R5681:Ngf UTSW 3 102520353 missense probably damaging 1.00
R7790:Ngf UTSW 3 102509824 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCTTGCAAATACAATTCCCC -3'
(R):5'- GTCCTTCATGCGTGAATATGC -3'

Sequencing Primer
(F):5'- TTTCATACGATGATTGCACCTG -3'
(R):5'- TATGCAGACTATCTAGCCAGCTGG -3'
Posted On2018-03-15