Mutagenetix > Incidental Mutations

Incidental Mutation 'R6259:Dab1'

506538

Institutional Source

Beutler Lab

Gene Symbol

Dab1

Ensembl Gene

ENSMUSG00000028519

Gene Name

disabled 1

Synonyms

C630028C02Rik

MMRRC Submission

044376-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.904) question?

Stock #

R6259 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103619359-104744844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104731751 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 524 (A524V)

Ref Sequence

ENSEMBL: ENSMUSP00000102443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]

Predicted Effect

probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	254	267	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	490	501	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146078

SMART Domains

Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	235	242	N/A	INTRINSIC

Meta Mutation Damage Score

0.2232

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,513	Y96C	probably benign	Het
5730507C01Rik	C	A	12: 18,534,119	N393K	probably benign	Het
Acap3	A	T	4: 155,896,118	I19F	possibly damaging	Het
Adamts5	C	T	16: 85,899,753	R172H	probably benign	Het
Adgra3	A	G	5: 49,999,141	F416L	possibly damaging	Het
Amy1	T	C	3: 113,569,410	D96G	possibly damaging	Het
Ank2	A	G	3: 127,016,986	S484P	probably benign	Het
Arsa	A	G	15: 89,475,521	C68R	probably damaging	Het
Asprv1	A	G	6: 86,628,379	Y69C	probably benign	Het
Ass1	A	G	2: 31,488,642	E162G	possibly damaging	Het
Atf7	G	T	15: 102,547,238	N230K	probably damaging	Het
Atp10b	A	G	11: 43,201,238	M367V	probably benign	Het
Atp11b	A	G	3: 35,806,901	Y179C	probably damaging	Het
BC004004	A	T	17: 29,298,712	Q300L	possibly damaging	Het
Bglap3	A	T	3: 88,368,760	I95N	probably damaging	Het
Cacna1h	T	C	17: 25,397,656		probably null	Het
Caskin2	C	T	11: 115,800,453	G1141D	probably damaging	Het
Clcn4	G	A	7: 7,291,530	R351W	possibly damaging	Het
Col11a1	T	C	3: 114,138,447	C89R	probably benign	Het
Csrp1	T	G	1: 135,739,514		probably null	Het
Cwf19l2	T	C	9: 3,458,879	I776T	probably damaging	Het
Cyp2b19	A	T	7: 26,771,392	Q486L	possibly damaging	Het
Cyp2j9	T	A	4: 96,584,006	Y165F	probably benign	Het
Dennd1c	G	A	17: 57,067,104	R522C	probably damaging	Het
Dmgdh	T	C	13: 93,752,308	V818A	probably benign	Het
Dst	T	A	1: 34,182,396	V2427E	probably benign	Het
Duox1	C	T	2: 122,344,783	T1354M	probably benign	Het
Ehbp1	A	G	11: 22,285,684		probably benign	Het
Epc2	T	A	2: 49,488,854		probably null	Het
Eya2	T	C	2: 165,716,099	V205A	probably benign	Het
Fam84a	T	A	12: 14,150,645	D27V	probably damaging	Het
Fat4	A	G	3: 39,007,246	H4326R	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm10100	G	T	10: 77,726,664	C60F	possibly damaging	Het
Hhip	T	A	8: 79,972,404	R678W	probably damaging	Het
Il21r	T	A	7: 125,630,719	I266K	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kif26b	T	C	1: 178,917,405	S1689P	probably damaging	Het
L3mbtl2	A	G	15: 81,681,927	E317G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrr1	A	G	12: 69,174,815	N244D	probably damaging	Het
Lrrk2	A	T	15: 91,702,247	H422L	probably benign	Het
Map4k5	A	G	12: 69,852,740	S46P	probably damaging	Het
Ngf	A	G	3: 102,509,797		probably benign	Het
Nploc4	T	C	11: 120,385,865	I452V	probably benign	Het
Oas1d	T	A	5: 120,919,181	Y283*	probably null	Het
Olfr1156	T	C	2: 87,949,435	N266S	probably benign	Het
Olfr1463	A	G	19: 13,234,421	H57R	probably damaging	Het
Olfr648	A	T	7: 104,180,054	M118K	possibly damaging	Het
Olfr689	A	T	7: 105,314,057	I18F	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Peg3	A	G	7: 6,709,811	V804A	probably damaging	Het
Piezo2	T	A	18: 63,117,678	Y450F	possibly damaging	Het
Pprc1	T	A	19: 46,064,410	V789E	probably damaging	Het
Prcc	A	G	3: 87,862,147	M436T	possibly damaging	Het
Prepl	A	T	17: 85,070,431	V507D	probably damaging	Het
Rag1	T	A	2: 101,644,452	N115I	possibly damaging	Het
Rap1gap	T	C	4: 137,681,757		probably null	Het
Reln	A	C	5: 22,060,333	F454V	probably damaging	Het
Slc39a11	A	T	11: 113,463,954	S150T	probably benign	Het
Slc45a1	T	A	4: 150,638,360	I356F	possibly damaging	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Stkld1	A	T	2: 26,949,381	D353V	possibly damaging	Het
Susd2	T	C	10: 75,638,046	S572G	probably damaging	Het
Synrg	T	A	11: 84,008,658	D563E	probably damaging	Het
Tmem131	C	T	1: 36,819,128	V713I	probably benign	Het
Tnfrsf8	A	G	4: 145,277,524		probably null	Het
Trim26	C	T	17: 36,856,218	A267V	probably benign	Het
Trpm1	T	G	7: 64,268,478	F522C	possibly damaging	Het
Uggt1	T	C	1: 36,234,916	I29V	probably benign	Het
Unc5d	C	T	8: 28,666,792	M808I	probably benign	Het
Vmn2r108	T	A	17: 20,463,109	D611V	possibly damaging	Het
Vps13a	A	C	19: 16,687,170	Y1436*	probably null	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp518a	G	T	19: 40,912,781	V385F	probably benign	Het
Zfp541	C	T	7: 16,095,526	A1222V	probably benign	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Dab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dab1	APN	4	104678810	missense	probably damaging	1.00
IGL00087:Dab1	APN	4	104678753	missense	possibly damaging	0.90
IGL00328:Dab1	APN	4	104688438	missense	possibly damaging	0.55
IGL00756:Dab1	APN	4	104727878	missense	probably benign
IGL02074:Dab1	APN	4	104727854	missense	possibly damaging	0.90
IGL02286:Dab1	APN	4	104680070	missense	probably damaging	1.00
IGL02986:Dab1	APN	4	104479221	missense	probably benign	0.00
IGL03008:Dab1	APN	4	104727580	missense	probably damaging	0.99
IGL03133:Dab1	APN	4	104727580	missense	probably benign	0.41
IGL03375:Dab1	APN	4	104681601	missense	possibly damaging	0.70
LCD18:Dab1	UTSW	4	104046572	intron	probably benign
R0027:Dab1	UTSW	4	104704199	intron	probably benign
R0466:Dab1	UTSW	4	104720550	missense	probably benign	0.15
R0838:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R0840:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1086:Dab1	UTSW	4	104328572	intron	probably benign
R1598:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1640:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1699:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1749:Dab1	UTSW	4	104328298	intron	probably benign
R1770:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1846:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1847:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1848:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1885:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1986:Dab1	UTSW	4	104613215	missense	probably damaging	0.97
R1990:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2006:Dab1	UTSW	4	104605325	missense	probably damaging	1.00
R2030:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2032:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2034:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2061:Dab1	UTSW	4	104678741	missense	probably damaging	1.00
R2088:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2089:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2092:Dab1	UTSW	4	104678777	missense	probably damaging	1.00
R2193:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2194:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2361:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2362:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2391:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2424:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2865:Dab1	UTSW	4	104680146	missense	probably benign
R3118:Dab1	UTSW	4	104680069	critical splice acceptor site	probably null
R3716:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3718:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3740:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3742:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3965:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4057:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4393:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4396:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4418:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4607:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4608:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4648:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4693:Dab1	UTSW	4	104679553	missense	probably damaging	1.00
R4701:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4730:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4760:Dab1	UTSW	4	104732145	missense	probably damaging	1.00
R4927:Dab1	UTSW	4	104704252	missense	probably benign
R5173:Dab1	UTSW	4	104688448	splice site	probably null
R5503:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6199:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6200:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6207:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6224:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6227:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6228:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6229:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6246:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6247:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6248:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6249:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6250:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6258:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6260:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6505:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6817:Dab1	UTSW	4	104679546	missense	probably damaging	1.00
R7305:Dab1	UTSW	4	104713790	missense
R7709:Dab1	UTSW	4	104720559	nonsense	probably null
R7894:Dab1	UTSW	4	104732138	missense	probably benign	0.03
R8142:Dab1	UTSW	4	104678724	missense	probably damaging	1.00
RF017:Dab1	UTSW	4	104713652	missense	probably benign	0.01
Z1088:Dab1	UTSW	4	104479232	missense	probably damaging	0.99
Z1176:Dab1	UTSW	4	104728078	missense	probably benign	0.00
Z1177:Dab1	UTSW	4	104727740	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATGGGATATAAATGGCTGTGGC -3'
(R):5'- TTACAGGAGGCTGAAACTTCCC -3'

Sequencing Primer
(F):5'- GGATATAAATGGCTGTGGCTTATATG -3'
(R):5'- TGAAACTTCCCCCAGAGGATG -3'

Posted On

2018-03-15