Incidental Mutation 'R6259:Rap1gap'
ID506539
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6259 (G1)
Quality Score116.008
Status Validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 137681757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000047243] [ENSMUST00000105835] [ENSMUST00000105835] [ENSMUST00000150928] [ENSMUST00000150928] [ENSMUST00000152567] [ENSMUST00000152567]
Predicted Effect probably null
Transcript: ENSMUST00000047243
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047243
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105835
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105835
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139831
Predicted Effect probably null
Transcript: ENSMUST00000150928
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150928
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152567
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Predicted Effect probably null
Transcript: ENSMUST00000152567
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156683
Meta Mutation Damage Score 0.8429 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
R7580:Rap1gap UTSW 4 137719982 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACAAGCGGCCCTTTCTGTG -3'
(R):5'- GCATCCTTTAGTCTCACACGAATG -3'

Sequencing Primer
(F):5'- TTTCTGTGCCGGGACCTCAG -3'
(R):5'- GTCTCACACGAATGTTTATCGACAC -3'
Posted On2018-03-15