Mutagenetix > Incidental Mutations

Incidental Mutation 'R6259:Tnfrsf8'

506540

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf8

Ensembl Gene

ENSMUSG00000028602

Gene Name

tumor necrosis factor receptor superfamily, member 8

Synonyms

CD30

MMRRC Submission

044376-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R6259 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145267137-145315164 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 145277524 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]

Predicted Effect

probably null
Transcript: ENSMUST00000030339

SMART Domains

Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
transmembrane domain	288	310	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123027

SMART Domains

Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,513	Y96C	probably benign	Het
5730507C01Rik	C	A	12: 18,534,119	N393K	probably benign	Het
Acap3	A	T	4: 155,896,118	I19F	possibly damaging	Het
Adamts5	C	T	16: 85,899,753	R172H	probably benign	Het
Adgra3	A	G	5: 49,999,141	F416L	possibly damaging	Het
Amy1	T	C	3: 113,569,410	D96G	possibly damaging	Het
Ank2	A	G	3: 127,016,986	S484P	probably benign	Het
Arsa	A	G	15: 89,475,521	C68R	probably damaging	Het
Asprv1	A	G	6: 86,628,379	Y69C	probably benign	Het
Ass1	A	G	2: 31,488,642	E162G	possibly damaging	Het
Atf7	G	T	15: 102,547,238	N230K	probably damaging	Het
Atp10b	A	G	11: 43,201,238	M367V	probably benign	Het
Atp11b	A	G	3: 35,806,901	Y179C	probably damaging	Het
BC004004	A	T	17: 29,298,712	Q300L	possibly damaging	Het
Bglap3	A	T	3: 88,368,760	I95N	probably damaging	Het
Cacna1h	T	C	17: 25,397,656		probably null	Het
Caskin2	C	T	11: 115,800,453	G1141D	probably damaging	Het
Clcn4	G	A	7: 7,291,530	R351W	possibly damaging	Het
Col11a1	T	C	3: 114,138,447	C89R	probably benign	Het
Csrp1	T	G	1: 135,739,514		probably null	Het
Cwf19l2	T	C	9: 3,458,879	I776T	probably damaging	Het
Cyp2b19	A	T	7: 26,771,392	Q486L	possibly damaging	Het
Cyp2j9	T	A	4: 96,584,006	Y165F	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dennd1c	G	A	17: 57,067,104	R522C	probably damaging	Het
Dmgdh	T	C	13: 93,752,308	V818A	probably benign	Het
Dst	T	A	1: 34,182,396	V2427E	probably benign	Het
Duox1	C	T	2: 122,344,783	T1354M	probably benign	Het
Ehbp1	A	G	11: 22,285,684		probably benign	Het
Epc2	T	A	2: 49,488,854		probably null	Het
Eya2	T	C	2: 165,716,099	V205A	probably benign	Het
Fam84a	T	A	12: 14,150,645	D27V	probably damaging	Het
Fat4	A	G	3: 39,007,246	H4326R	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm10100	G	T	10: 77,726,664	C60F	possibly damaging	Het
Hhip	T	A	8: 79,972,404	R678W	probably damaging	Het
Il21r	T	A	7: 125,630,719	I266K	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kif26b	T	C	1: 178,917,405	S1689P	probably damaging	Het
L3mbtl2	A	G	15: 81,681,927	E317G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrr1	A	G	12: 69,174,815	N244D	probably damaging	Het
Lrrk2	A	T	15: 91,702,247	H422L	probably benign	Het
Map4k5	A	G	12: 69,852,740	S46P	probably damaging	Het
Ngf	A	G	3: 102,509,797		probably benign	Het
Nploc4	T	C	11: 120,385,865	I452V	probably benign	Het
Oas1d	T	A	5: 120,919,181	Y283*	probably null	Het
Olfr1156	T	C	2: 87,949,435	N266S	probably benign	Het
Olfr1463	A	G	19: 13,234,421	H57R	probably damaging	Het
Olfr648	A	T	7: 104,180,054	M118K	possibly damaging	Het
Olfr689	A	T	7: 105,314,057	I18F	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Peg3	A	G	7: 6,709,811	V804A	probably damaging	Het
Piezo2	T	A	18: 63,117,678	Y450F	possibly damaging	Het
Pprc1	T	A	19: 46,064,410	V789E	probably damaging	Het
Prcc	A	G	3: 87,862,147	M436T	possibly damaging	Het
Prepl	A	T	17: 85,070,431	V507D	probably damaging	Het
Rag1	T	A	2: 101,644,452	N115I	possibly damaging	Het
Rap1gap	T	C	4: 137,681,757		probably null	Het
Reln	A	C	5: 22,060,333	F454V	probably damaging	Het
Slc39a11	A	T	11: 113,463,954	S150T	probably benign	Het
Slc45a1	T	A	4: 150,638,360	I356F	possibly damaging	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Stkld1	A	T	2: 26,949,381	D353V	possibly damaging	Het
Susd2	T	C	10: 75,638,046	S572G	probably damaging	Het
Synrg	T	A	11: 84,008,658	D563E	probably damaging	Het
Tmem131	C	T	1: 36,819,128	V713I	probably benign	Het
Trim26	C	T	17: 36,856,218	A267V	probably benign	Het
Trpm1	T	G	7: 64,268,478	F522C	possibly damaging	Het
Uggt1	T	C	1: 36,234,916	I29V	probably benign	Het
Unc5d	C	T	8: 28,666,792	M808I	probably benign	Het
Vmn2r108	T	A	17: 20,463,109	D611V	possibly damaging	Het
Vps13a	A	C	19: 16,687,170	Y1436*	probably null	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp518a	G	T	19: 40,912,781	V385F	probably benign	Het
Zfp541	C	T	7: 16,095,526	A1222V	probably benign	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Tnfrsf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Tnfrsf8	APN	4	145292591	splice site	probably null
IGL02815:Tnfrsf8	APN	4	145298778	missense	possibly damaging	0.68
IGL02819:Tnfrsf8	APN	4	145269133	missense	probably damaging	1.00
IGL03033:Tnfrsf8	APN	4	145292649	missense	possibly damaging	0.86
IGL03105:Tnfrsf8	APN	4	145298784	missense	probably damaging	1.00
IGL02837:Tnfrsf8	UTSW	4	145268998	missense	probably benign	0.10
R0114:Tnfrsf8	UTSW	4	145288047	missense	possibly damaging	0.95
R0326:Tnfrsf8	UTSW	4	145288459	missense	possibly damaging	0.64
R0594:Tnfrsf8	UTSW	4	145296861	missense	probably damaging	1.00
R0639:Tnfrsf8	UTSW	4	145288027	missense	probably benign	0.24
R0826:Tnfrsf8	UTSW	4	145285138	splice site	probably benign
R3056:Tnfrsf8	UTSW	4	145285325	critical splice donor site	probably null
R4700:Tnfrsf8	UTSW	4	145303122	missense	probably damaging	0.99
R4765:Tnfrsf8	UTSW	4	145296877	missense	probably benign	0.19
R5149:Tnfrsf8	UTSW	4	145303105	missense	possibly damaging	0.53
R5452:Tnfrsf8	UTSW	4	145292644	missense	possibly damaging	0.96
R5632:Tnfrsf8	UTSW	4	145292633	missense	possibly damaging	0.68
R5673:Tnfrsf8	UTSW	4	145285335	missense	probably benign	0.14
R5877:Tnfrsf8	UTSW	4	145292687	missense	probably benign	0.20
R6243:Tnfrsf8	UTSW	4	145303101	missense	possibly damaging	0.61
R6326:Tnfrsf8	UTSW	4	145269224	missense	probably damaging	1.00
R6603:Tnfrsf8	UTSW	4	145292598	missense	possibly damaging	0.70
R7025:Tnfrsf8	UTSW	4	145274403	missense	possibly damaging	0.87
R7156:Tnfrsf8	UTSW	4	145315084	start codon destroyed	unknown
R7313:Tnfrsf8	UTSW	4	145274382	missense	probably benign	0.33
R7505:Tnfrsf8	UTSW	4	145269115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCCTTCTATGGCCCTAG -3'
(R):5'- ATTGTCTACTGCCAGCCTAGG -3'

Sequencing Primer
(F):5'- AGAGCACTGACTGTTCTTCCAGAG -3'
(R):5'- CCAGGGTGCTATCTGTTA -3'

Posted On

2018-03-15