Mutagenetix > Incidental Mutation

Incidental Mutation 'R6259:Wdfy3'

506545

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

MMRRC Submission

044376-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R6259 (G1)

Quality Score

191.009

Status

Validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101872965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 2491 (R2491Q)

Ref Sequence

ENSEMBL: ENSMUSP00000134244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053177
AA Change: R2473Q

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: R2473Q

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174598
AA Change: R2491Q

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: R2491Q

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212024
AA Change: R2477Q

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,513	Y96C	probably benign	Het
5730507C01Rik	C	A	12: 18,534,119	N393K	probably benign	Het
Acap3	A	T	4: 155,896,118	I19F	possibly damaging	Het
Adamts5	C	T	16: 85,899,753	R172H	probably benign	Het
Adgra3	A	G	5: 49,999,141	F416L	possibly damaging	Het
Amy1	T	C	3: 113,569,410	D96G	possibly damaging	Het
Ank2	A	G	3: 127,016,986	S484P	probably benign	Het
Arsa	A	G	15: 89,475,521	C68R	probably damaging	Het
Asprv1	A	G	6: 86,628,379	Y69C	probably benign	Het
Ass1	A	G	2: 31,488,642	E162G	possibly damaging	Het
Atf7	G	T	15: 102,547,238	N230K	probably damaging	Het
Atp10b	A	G	11: 43,201,238	M367V	probably benign	Het
Atp11b	A	G	3: 35,806,901	Y179C	probably damaging	Het
BC004004	A	T	17: 29,298,712	Q300L	possibly damaging	Het
Bglap3	A	T	3: 88,368,760	I95N	probably damaging	Het
Cacna1h	T	C	17: 25,397,656		probably null	Het
Caskin2	C	T	11: 115,800,453	G1141D	probably damaging	Het
Clcn4	G	A	7: 7,291,530	R351W	possibly damaging	Het
Col11a1	T	C	3: 114,138,447	C89R	probably benign	Het
Csrp1	T	G	1: 135,739,514		probably null	Het
Cwf19l2	T	C	9: 3,458,879	I776T	probably damaging	Het
Cyp2b19	A	T	7: 26,771,392	Q486L	possibly damaging	Het
Cyp2j9	T	A	4: 96,584,006	Y165F	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dennd1c	G	A	17: 57,067,104	R522C	probably damaging	Het
Dmgdh	T	C	13: 93,752,308	V818A	probably benign	Het
Dst	T	A	1: 34,182,396	V2427E	probably benign	Het
Duox1	C	T	2: 122,344,783	T1354M	probably benign	Het
Ehbp1	A	G	11: 22,285,684		probably benign	Het
Epc2	T	A	2: 49,488,854		probably null	Het
Eya2	T	C	2: 165,716,099	V205A	probably benign	Het
Fam84a	T	A	12: 14,150,645	D27V	probably damaging	Het
Fat4	A	G	3: 39,007,246	H4326R	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm10100	G	T	10: 77,726,664	C60F	possibly damaging	Het
Hhip	T	A	8: 79,972,404	R678W	probably damaging	Het
Il21r	T	A	7: 125,630,719	I266K	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kif26b	T	C	1: 178,917,405	S1689P	probably damaging	Het
L3mbtl2	A	G	15: 81,681,927	E317G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrr1	A	G	12: 69,174,815	N244D	probably damaging	Het
Lrrk2	A	T	15: 91,702,247	H422L	probably benign	Het
Map4k5	A	G	12: 69,852,740	S46P	probably damaging	Het
Ngf	A	G	3: 102,509,797		probably benign	Het
Nploc4	T	C	11: 120,385,865	I452V	probably benign	Het
Oas1d	T	A	5: 120,919,181	Y283*	probably null	Het
Olfr1156	T	C	2: 87,949,435	N266S	probably benign	Het
Olfr1463	A	G	19: 13,234,421	H57R	probably damaging	Het
Olfr648	A	T	7: 104,180,054	M118K	possibly damaging	Het
Olfr689	A	T	7: 105,314,057	I18F	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Peg3	A	G	7: 6,709,811	V804A	probably damaging	Het
Piezo2	T	A	18: 63,117,678	Y450F	possibly damaging	Het
Pprc1	T	A	19: 46,064,410	V789E	probably damaging	Het
Prcc	A	G	3: 87,862,147	M436T	possibly damaging	Het
Prepl	A	T	17: 85,070,431	V507D	probably damaging	Het
Rag1	T	A	2: 101,644,452	N115I	possibly damaging	Het
Rap1gap	T	C	4: 137,681,757		probably null	Het
Reln	A	C	5: 22,060,333	F454V	probably damaging	Het
Slc39a11	A	T	11: 113,463,954	S150T	probably benign	Het
Slc45a1	T	A	4: 150,638,360	I356F	possibly damaging	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Stkld1	A	T	2: 26,949,381	D353V	possibly damaging	Het
Susd2	T	C	10: 75,638,046	S572G	probably damaging	Het
Synrg	T	A	11: 84,008,658	D563E	probably damaging	Het
Tmem131	C	T	1: 36,819,128	V713I	probably benign	Het
Tnfrsf8	A	G	4: 145,277,524		probably null	Het
Trim26	C	T	17: 36,856,218	A267V	probably benign	Het
Trpm1	T	G	7: 64,268,478	F522C	possibly damaging	Het
Uggt1	T	C	1: 36,234,916	I29V	probably benign	Het
Unc5d	C	T	8: 28,666,792	M808I	probably benign	Het
Vmn2r108	T	A	17: 20,463,109	D611V	possibly damaging	Het
Vps13a	A	C	19: 16,687,170	Y1436*	probably null	Het
Zfp518a	G	T	19: 40,912,781	V385F	probably benign	Het
Zfp541	C	T	7: 16,095,526	A1222V	probably benign	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0025:Wdfy3	UTSW	5	101845046	missense	probably damaging	0.98
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0513:Wdfy3	UTSW	5	101890789	missense	probably damaging	0.96
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1854:Wdfy3	UTSW	5	101888186	missense	probably benign	0.05
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4624:Wdfy3	UTSW	5	101884083	missense	possibly damaging	0.52
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9545:Wdfy3	UTSW	5	101953091	missense
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CTGTCTTGGGACACTCTGTC -3'
(R):5'- GTGTTTAATCCTCAAGCCTGC -3'

Sequencing Primer
(F):5'- TGTCCCCAGGGGCAGTAC -3'
(R):5'- CTAAAGTGTTCCCCTCAGAGGTG -3'

Posted On

2018-03-15