Incidental Mutation 'R6259:Il21r'
ID506555
Institutional Source Beutler Lab
Gene Symbol Il21r
Ensembl Gene ENSMUSG00000030745
Gene Nameinterleukin 21 receptor
SynonymsNILR
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location125603429-125633570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125630719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 266 (I266K)
Ref Sequence ENSEMBL: ENSMUSP00000033000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033000
AA Change: I266K

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: I266K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 120 209 3.4e0 SMART
low complexity region 239 250 N/A INTRINSIC
low complexity region 307 312 N/A INTRINSIC
low complexity region 424 450 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206103
AA Change: Y234N

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206234
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Il21r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Il21r APN 7 125632525 missense probably damaging 1.00
bellflower UTSW 7 125628043 critical splice acceptor site probably null
R0409:Il21r UTSW 7 125629840 intron probably benign
R0573:Il21r UTSW 7 125625285 missense probably benign 0.06
R0635:Il21r UTSW 7 125632506 missense probably damaging 1.00
R1933:Il21r UTSW 7 125628981 missense possibly damaging 0.92
R1969:Il21r UTSW 7 125628972 missense probably damaging 0.99
R3716:Il21r UTSW 7 125632269 missense probably damaging 0.96
R3968:Il21r UTSW 7 125628043 critical splice acceptor site probably null
R4546:Il21r UTSW 7 125628899 missense probably damaging 1.00
R5086:Il21r UTSW 7 125632855 missense probably damaging 0.99
R5566:Il21r UTSW 7 125625298 missense probably damaging 1.00
R5988:Il21r UTSW 7 125632288 missense probably damaging 0.99
R6234:Il21r UTSW 7 125632585 missense probably damaging 1.00
R6896:Il21r UTSW 7 125626956 missense probably damaging 1.00
R7162:Il21r UTSW 7 125632311 missense probably benign 0.00
R7263:Il21r UTSW 7 125632905 missense probably benign 0.04
R7740:Il21r UTSW 7 125632555 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTGAACATCTGCAGGAAGC -3'
(R):5'- CCACACCTTGCAGAATAGGG -3'

Sequencing Primer
(F):5'- CATCTGCAGGAAGCTTGGG -3'
(R):5'- CTAGTTCTAGGTAGGATGGACCAG -3'
Posted On2018-03-15