Incidental Mutation 'R6259:Atp10b'
ID506563
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene NameATPase, class V, type 10B
Synonyms5930426O13Rik, 9030605H24Rik
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location43149877-43262285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43201238 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 367 (M367V)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
Predicted Effect probably benign
Transcript: ENSMUST00000077659
AA Change: M367V

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: M367V

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137991
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43202161 missense probably damaging 1.00
IGL01385:Atp10b APN 11 43234429 missense probably damaging 1.00
IGL01524:Atp10b APN 11 43259845 missense probably benign 0.18
IGL01575:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01588:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01590:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01832:Atp10b APN 11 43234435 missense probably damaging 0.98
IGL01927:Atp10b APN 11 43259404 splice site probably benign
IGL01933:Atp10b APN 11 43194630 missense probably damaging 1.00
IGL02182:Atp10b APN 11 43248947 missense probably damaging 1.00
IGL02215:Atp10b APN 11 43194665 critical splice donor site probably null
IGL02216:Atp10b APN 11 43259789 missense probably damaging 0.98
IGL02973:Atp10b APN 11 43197509 missense probably damaging 1.00
IGL03012:Atp10b APN 11 43194655 missense probably damaging 0.99
IGL03106:Atp10b APN 11 43247477 missense probably benign 0.32
IGL03123:Atp10b APN 11 43153283 missense probably benign 0.01
IGL03202:Atp10b APN 11 43234441 critical splice donor site probably null
IGL03339:Atp10b APN 11 43230615 missense probably null 0.71
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0281:Atp10b UTSW 11 43153304 missense probably benign 0.00
R0379:Atp10b UTSW 11 43254314 missense probably benign 0.05
R0380:Atp10b UTSW 11 43225597 missense probably damaging 1.00
R0470:Atp10b UTSW 11 43203039 missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43151655 nonsense probably null
R1368:Atp10b UTSW 11 43202154 missense probably damaging 1.00
R1370:Atp10b UTSW 11 43151655 nonsense probably null
R1413:Atp10b UTSW 11 43230564 missense probably benign 0.00
R1502:Atp10b UTSW 11 43230347 missense probably damaging 1.00
R1530:Atp10b UTSW 11 43197524 missense probably benign 0.03
R1596:Atp10b UTSW 11 43235767 missense probably damaging 1.00
R1675:Atp10b UTSW 11 43225648 missense probably damaging 1.00
R1880:Atp10b UTSW 11 43259432 missense probably damaging 1.00
R1938:Atp10b UTSW 11 43230418 missense probably benign 0.00
R1986:Atp10b UTSW 11 43172768 missense probably benign 0.12
R2081:Atp10b UTSW 11 43202128 missense probably damaging 1.00
R2083:Atp10b UTSW 11 43212423 missense probably benign 0.24
R2159:Atp10b UTSW 11 43151853 missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43234380 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43172745 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43189613 missense probably damaging 1.00
R3741:Atp10b UTSW 11 43235662 missense probably damaging 1.00
R3942:Atp10b UTSW 11 43172754 missense probably damaging 1.00
R3971:Atp10b UTSW 11 43216512 missense probably damaging 1.00
R4007:Atp10b UTSW 11 43259852 missense probably benign 0.04
R4050:Atp10b UTSW 11 43259536 missense probably benign 0.00
R4078:Atp10b UTSW 11 43153283 missense probably benign 0.01
R4567:Atp10b UTSW 11 43197557 missense probably benign 0.03
R4651:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4652:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4667:Atp10b UTSW 11 43247518 missense probably damaging 1.00
R4720:Atp10b UTSW 11 43203122 missense probably benign
R4987:Atp10b UTSW 11 43151613 utr 5 prime probably benign
R5232:Atp10b UTSW 11 43202179 missense probably damaging 1.00
R5233:Atp10b UTSW 11 43230560 missense probably benign 0.06
R5281:Atp10b UTSW 11 43254336 missense probably damaging 0.97
R5307:Atp10b UTSW 11 43212475 missense probably damaging 1.00
R5460:Atp10b UTSW 11 43230455 missense probably benign 0.00
R5518:Atp10b UTSW 11 43151636 missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43245425 missense probably damaging 1.00
R5688:Atp10b UTSW 11 43201173 missense probably benign 0.00
R5735:Atp10b UTSW 11 43151774 missense probably benign 0.00
R6153:Atp10b UTSW 11 43254282 missense probably damaging 1.00
R6251:Atp10b UTSW 11 43235746 missense possibly damaging 0.95
R6394:Atp10b UTSW 11 43225637 missense probably damaging 1.00
R6492:Atp10b UTSW 11 43218957 missense probably damaging 1.00
R6769:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6771:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6775:Atp10b UTSW 11 43222213 missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43245464 missense probably damaging 1.00
R7322:Atp10b UTSW 11 43212547 missense probably damaging 1.00
R7367:Atp10b UTSW 11 43247501 missense probably damaging 1.00
R7538:Atp10b UTSW 11 43225546 missense probably benign 0.04
R7708:Atp10b UTSW 11 43202143 missense probably damaging 1.00
R7787:Atp10b UTSW 11 43259873 missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43202122 missense probably damaging 1.00
R8406:Atp10b UTSW 11 43203157 missense probably benign 0.00
R8503:Atp10b UTSW 11 43222239 missense possibly damaging 0.92
Z1177:Atp10b UTSW 11 43153349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTGCCTAAAGGTACCTGATAAC -3'
(R):5'- GGGATGCACACATGTTGCTG -3'

Sequencing Primer
(F):5'- CTTAAGGACTAAGGAGAGATTGTGTC -3'
(R):5'- TCTCCAGCAGCTCTCTGAGG -3'
Posted On2018-03-15