Incidental Mutation 'R6259:Lrr1'
ID506572
Institutional Source Beutler Lab
Gene Symbol Lrr1
Ensembl Gene ENSMUSG00000034883
Gene Nameleucine rich repeat protein 1
SynonymsLRR-1, Ppil5, 2410005L11Rik
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69168814-69179009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69174815 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 244 (N244D)
Ref Sequence ENSEMBL: ENSMUSP00000106251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110621] [ENSMUST00000222520]
Predicted Effect probably damaging
Transcript: ENSMUST00000110621
AA Change: N244D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106251
Gene: ENSMUSG00000034883
AA Change: N244D

DomainStartEndE-ValueType
LRR 184 206 8.09e-1 SMART
LRR 207 230 4.57e0 SMART
LRR 234 255 7.17e1 SMART
LRR 256 278 1.71e2 SMART
LRR 279 301 6.05e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222382
Predicted Effect probably benign
Transcript: ENSMUST00000222520
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat (LRR). It specifically interacts with TNFRSF9/4-1BB, a member of the tumor necrosis factor receptor (TNFR) superfamily. Overexpression of this gene suppresses the activation of NF-kappa B induced by TNFRSF9 or TNF receptor-associated factor 2 (TRAF2), which suggests that this protein is a negative regulator of TNFRSF9-mediated signaling cascades. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Lrr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Lrr1 APN 12 69174582 missense probably benign 0.04
IGL02399:Lrr1 APN 12 69168891 nonsense probably null
R0525:Lrr1 UTSW 12 69168911 missense probably damaging 1.00
R1187:Lrr1 UTSW 12 69175022 missense probably benign 0.01
R2375:Lrr1 UTSW 12 69174923 missense probably benign 0.00
R4748:Lrr1 UTSW 12 69174462 missense probably benign 0.29
R5283:Lrr1 UTSW 12 69174654 missense probably damaging 1.00
R5830:Lrr1 UTSW 12 69178671 missense possibly damaging 0.63
R6264:Lrr1 UTSW 12 69168881 missense probably damaging 1.00
R6788:Lrr1 UTSW 12 69174675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGAGTTGATATGCGTATGC -3'
(R):5'- AAGATCCAAGTACTCCAGGGATAAC -3'

Sequencing Primer
(F):5'- CGAGTTGATATGCGTATGCTGTGC -3'
(R):5'- AGGGATAACATTTTAAATTCAGAGGG -3'
Posted On2018-03-15