Incidental Mutation 'R6259:L3mbtl2'
ID506575
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene NameL3MBTL2 polycomb repressive complex 1 subunit
Synonymsm4mbt, 4732493N06Rik
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6259 (G1)
Quality Score124.008
Status Validated
Chromosome15
Chromosomal Location81663889-81688315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81681927 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 317 (E317G)
Ref Sequence ENSEMBL: ENSMUSP00000133967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000072910] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
Predicted Effect probably damaging
Transcript: ENSMUST00000023029
AA Change: E317G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: E317G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072910
SMART Domains Protein: ENSMUSP00000072682
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
LRRNT 31 65 3.72e-4 SMART
LRR 59 83 1e1 SMART
LRR_TYP 84 107 7.78e-3 SMART
LRR_TYP 108 131 5.81e-2 SMART
LRR_TYP 132 155 3.89e-3 SMART
LRR_TYP 156 179 6.42e-4 SMART
LRR 180 203 1.37e1 SMART
LRR_TYP 204 227 5.5e-3 SMART
LRR 252 275 3.24e0 SMART
LRR 276 299 2.92e1 SMART
LRRCT 309 357 3.81e-2 SMART
low complexity region 358 372 N/A INTRINSIC
LRRNT 394 428 1.51e-4 SMART
LRR 427 446 1.26e2 SMART
LRR 447 470 3.97e0 SMART
LRR 471 494 1.08e-1 SMART
LRR 496 518 6.23e1 SMART
LRR 519 542 9.48e0 SMART
LRR 544 566 6.96e0 SMART
LRR 568 590 1.14e0 SMART
LRR_TYP 591 614 7.09e-6 SMART
LRR 617 639 3.76e1 SMART
LRR 640 665 6.59e1 SMART
LRRCT 674 722 2.87e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172568
AA Change: E317G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect probably damaging
Transcript: ENSMUST00000172748
AA Change: E317G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: E317G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173761
Predicted Effect probably benign
Transcript: ENSMUST00000173898
SMART Domains Protein: ENSMUSP00000133981
Gene: ENSMUSG00000063765

DomainStartEndE-ValueType
LRR 21 40 1.26e2 SMART
LRR 41 64 3.97e0 SMART
LRR 65 88 1.08e-1 SMART
LRR 90 112 6.23e1 SMART
LRR 113 136 9.48e0 SMART
LRR 138 160 6.96e0 SMART
LRR 162 184 1.14e0 SMART
LRR_TYP 185 208 7.09e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174229
AA Change: E317G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: E317G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect probably benign
Transcript: ENSMUST00000174497
SMART Domains Protein: ENSMUSP00000133549
Gene: ENSMUSG00000022394

DomainStartEndE-ValueType
Pfam:MBT 12 85 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174401
Meta Mutation Damage Score 0.6341 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81684898 missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81671125 missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81676392 missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81686255 missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81681993 missense probably damaging 1.00
PIT4431001:L3mbtl2 UTSW 15 81676307 missense probably benign 0.32
R0393:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81684286 splice site probably benign
R1263:L3mbtl2 UTSW 15 81682968 missense probably benign 0.00
R1426:L3mbtl2 UTSW 15 81676317 missense possibly damaging 0.95
R1542:L3mbtl2 UTSW 15 81682151 missense probably null 0.45
R1556:L3mbtl2 UTSW 15 81682002 missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81675621 missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81682014 missense possibly damaging 0.94
R2237:L3mbtl2 UTSW 15 81684330 missense probably benign
R4112:L3mbtl2 UTSW 15 81681969 missense possibly damaging 0.90
R4577:L3mbtl2 UTSW 15 81686285 missense probably benign
R4583:L3mbtl2 UTSW 15 81684906 missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81682612 missense probably benign
R4787:L3mbtl2 UTSW 15 81663974 utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81684333 missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81684871 missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81686942 missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81667354 missense probably benign
R7178:L3mbtl2 UTSW 15 81671074 missense probably benign 0.00
R7311:L3mbtl2 UTSW 15 81667387 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCTGTCCTGACCCTTAAAACAAAG -3'
(R):5'- GGGGACTCCACATATGGCAC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TATGGCACCAGAAGTCGTCATC -3'
Posted On2018-03-15