Incidental Mutation 'R6259:Atf7'
ID506579
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Nameactivating transcription factor 7
Synonyms
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102525946-102625464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102547238 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 230 (N230K)
Ref Sequence ENSEMBL: ENSMUSP00000130130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108828] [ENSMUST00000169033] [ENSMUST00000183452] [ENSMUST00000183765] [ENSMUST00000184077] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906] [ENSMUST00000185070]
Predicted Effect probably damaging
Transcript: ENSMUST00000108828
AA Change: N230K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104456
Gene: ENSMUSG00000099083
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169033
AA Change: N230K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130130
Gene: ENSMUSG00000099083
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183452
SMART Domains Protein: ENSMUSP00000139367
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183727
Predicted Effect probably benign
Transcript: ENSMUST00000183765
SMART Domains Protein: ENSMUSP00000139054
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184077
SMART Domains Protein: ENSMUSP00000139217
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184485
AA Change: N230K

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184616
AA Change: N230K

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184772
AA Change: N230K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184906
AA Change: N230K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083
AA Change: N230K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185070
SMART Domains Protein: ENSMUSP00000139379
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102551478 nonsense probably null
R2183:Atf7 UTSW 15 102546473 missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102529004 intron probably benign
R3114:Atf7 UTSW 15 102534423 missense probably benign 0.10
R3115:Atf7 UTSW 15 102534423 missense probably benign 0.10
R4544:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4545:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4546:Atf7 UTSW 15 102534327 missense probably benign 0.08
R5148:Atf7 UTSW 15 102547173 missense probably benign 0.02
R5568:Atf7 UTSW 15 102563322 missense probably damaging 0.99
R5688:Atf7 UTSW 15 102551509 missense probably damaging 1.00
R5805:Atf7 UTSW 15 102557587 splice site probably null
R6021:Atf7 UTSW 15 102557473 missense probably benign 0.20
R6347:Atf7 UTSW 15 102546479 missense possibly damaging 0.91
R6476:Atf7 UTSW 15 102593712 missense probably benign 0.13
R6794:Atf7 UTSW 15 102557465 missense probably benign 0.09
R7104:Atf7 UTSW 15 102534235 missense probably benign 0.40
R7369:Atf7 UTSW 15 102553809 missense probably damaging 0.98
R8111:Atf7 UTSW 15 102563334 missense probably damaging 0.96
R8244:Atf7 UTSW 15 102528866 missense unknown
X0027:Atf7 UTSW 15 102593670 critical splice donor site probably null
Z1088:Atf7 UTSW 15 102547182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCTTTTCCAACCCCACAG -3'
(R):5'- AGATGATTTCCCAGGCTATCCC -3'

Sequencing Primer
(F):5'- CCACAGCAGAATATCTTTAGCTATGC -3'
(R):5'- ATCCCTGCTTGTCTTGTGAG -3'
Posted On2018-03-15