Mutagenetix > Incidental Mutations

Incidental Mutation 'R6259:Adamts5'

506580

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

044376-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R6259 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85899753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 172 (R172H)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably benign
Transcript: ENSMUST00000023611
AA Change: R172H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: R172H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,513	Y96C	probably benign	Het
5730507C01Rik	C	A	12: 18,534,119	N393K	probably benign	Het
Acap3	A	T	4: 155,896,118	I19F	possibly damaging	Het
Adgra3	A	G	5: 49,999,141	F416L	possibly damaging	Het
Amy1	T	C	3: 113,569,410	D96G	possibly damaging	Het
Ank2	A	G	3: 127,016,986	S484P	probably benign	Het
Arsa	A	G	15: 89,475,521	C68R	probably damaging	Het
Asprv1	A	G	6: 86,628,379	Y69C	probably benign	Het
Ass1	A	G	2: 31,488,642	E162G	possibly damaging	Het
Atf7	G	T	15: 102,547,238	N230K	probably damaging	Het
Atp10b	A	G	11: 43,201,238	M367V	probably benign	Het
Atp11b	A	G	3: 35,806,901	Y179C	probably damaging	Het
BC004004	A	T	17: 29,298,712	Q300L	possibly damaging	Het
Bglap3	A	T	3: 88,368,760	I95N	probably damaging	Het
Cacna1h	T	C	17: 25,397,656		probably null	Het
Caskin2	C	T	11: 115,800,453	G1141D	probably damaging	Het
Clcn4	G	A	7: 7,291,530	R351W	possibly damaging	Het
Col11a1	T	C	3: 114,138,447	C89R	probably benign	Het
Csrp1	T	G	1: 135,739,514		probably null	Het
Cwf19l2	T	C	9: 3,458,879	I776T	probably damaging	Het
Cyp2b19	A	T	7: 26,771,392	Q486L	possibly damaging	Het
Cyp2j9	T	A	4: 96,584,006	Y165F	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dennd1c	G	A	17: 57,067,104	R522C	probably damaging	Het
Dmgdh	T	C	13: 93,752,308	V818A	probably benign	Het
Dst	T	A	1: 34,182,396	V2427E	probably benign	Het
Duox1	C	T	2: 122,344,783	T1354M	probably benign	Het
Ehbp1	A	G	11: 22,285,684		probably benign	Het
Epc2	T	A	2: 49,488,854		probably null	Het
Eya2	T	C	2: 165,716,099	V205A	probably benign	Het
Fam84a	T	A	12: 14,150,645	D27V	probably damaging	Het
Fat4	A	G	3: 39,007,246	H4326R	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm10100	G	T	10: 77,726,664	C60F	possibly damaging	Het
Hhip	T	A	8: 79,972,404	R678W	probably damaging	Het
Il21r	T	A	7: 125,630,719	I266K	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kif26b	T	C	1: 178,917,405	S1689P	probably damaging	Het
L3mbtl2	A	G	15: 81,681,927	E317G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrr1	A	G	12: 69,174,815	N244D	probably damaging	Het
Lrrk2	A	T	15: 91,702,247	H422L	probably benign	Het
Map4k5	A	G	12: 69,852,740	S46P	probably damaging	Het
Ngf	A	G	3: 102,509,797		probably benign	Het
Nploc4	T	C	11: 120,385,865	I452V	probably benign	Het
Oas1d	T	A	5: 120,919,181	Y283*	probably null	Het
Olfr1156	T	C	2: 87,949,435	N266S	probably benign	Het
Olfr1463	A	G	19: 13,234,421	H57R	probably damaging	Het
Olfr648	A	T	7: 104,180,054	M118K	possibly damaging	Het
Olfr689	A	T	7: 105,314,057	I18F	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Peg3	A	G	7: 6,709,811	V804A	probably damaging	Het
Piezo2	T	A	18: 63,117,678	Y450F	possibly damaging	Het
Pprc1	T	A	19: 46,064,410	V789E	probably damaging	Het
Prcc	A	G	3: 87,862,147	M436T	possibly damaging	Het
Prepl	A	T	17: 85,070,431	V507D	probably damaging	Het
Rag1	T	A	2: 101,644,452	N115I	possibly damaging	Het
Rap1gap	T	C	4: 137,681,757		probably null	Het
Reln	A	C	5: 22,060,333	F454V	probably damaging	Het
Slc39a11	A	T	11: 113,463,954	S150T	probably benign	Het
Slc45a1	T	A	4: 150,638,360	I356F	possibly damaging	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Stkld1	A	T	2: 26,949,381	D353V	possibly damaging	Het
Susd2	T	C	10: 75,638,046	S572G	probably damaging	Het
Synrg	T	A	11: 84,008,658	D563E	probably damaging	Het
Tmem131	C	T	1: 36,819,128	V713I	probably benign	Het
Tnfrsf8	A	G	4: 145,277,524		probably null	Het
Trim26	C	T	17: 36,856,218	A267V	probably benign	Het
Trpm1	T	G	7: 64,268,478	F522C	possibly damaging	Het
Uggt1	T	C	1: 36,234,916	I29V	probably benign	Het
Unc5d	C	T	8: 28,666,792	M808I	probably benign	Het
Vmn2r108	T	A	17: 20,463,109	D611V	possibly damaging	Het
Vps13a	A	C	19: 16,687,170	Y1436*	probably null	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp518a	G	T	19: 40,912,781	V385F	probably benign	Het
Zfp541	C	T	7: 16,095,526	A1222V	probably benign	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCAGATGGCGAGAAAGC -3'
(R):5'- TAGCATCGTTACTGCAGGAGGAG -3'

Sequencing Primer
(F):5'- TGAGCGTCTCCTAGATCTACTGTG -3'
(R):5'- TTACTGCAGGAGGAGGGCTG -3'

Posted On

2018-03-15