Incidental Mutation 'R6259:Dennd1c'
ID506586
Institutional Source Beutler Lab
Gene Symbol Dennd1c
Ensembl Gene ENSMUSG00000002668
Gene NameDENN/MADD domain containing 1C
Synonyms4432409M07Rik
MMRRC Submission 044376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57066056-57078510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57067104 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 522 (R522C)
Ref Sequence ENSEMBL: ENSMUSP00000011623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071826] [ENSMUST00000097299] [ENSMUST00000163628] [ENSMUST00000163763] [ENSMUST00000169543]
Predicted Effect probably damaging
Transcript: ENSMUST00000011623
AA Change: R522C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668
AA Change: R522C

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071826
SMART Domains Protein: ENSMUSP00000071729
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097299
SMART Domains Protein: ENSMUSP00000094902
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163628
SMART Domains Protein: ENSMUSP00000126402
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1fwxa1 30 52 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163763
SMART Domains Protein: ENSMUSP00000132502
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169543
SMART Domains Protein: ENSMUSP00000125760
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.1075 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rag1 T A 2: 101,644,452 N115I possibly damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Dennd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Dennd1c APN 17 57066839 missense probably damaging 0.99
IGL02729:Dennd1c APN 17 57066637 missense probably benign 0.34
IGL03185:Dennd1c APN 17 57066803 missense probably benign 0.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0288:Dennd1c UTSW 17 57076870 splice site probably null
R0380:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0381:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0389:Dennd1c UTSW 17 57067649 missense probably benign 0.02
R1528:Dennd1c UTSW 17 57066935 missense probably benign
R1892:Dennd1c UTSW 17 57067083 missense probably benign 0.00
R1936:Dennd1c UTSW 17 57073889 splice site probably benign
R2216:Dennd1c UTSW 17 57074492 critical splice donor site probably null
R3021:Dennd1c UTSW 17 57074180 critical splice acceptor site probably null
R3160:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R4133:Dennd1c UTSW 17 57076980 missense possibly damaging 0.53
R4831:Dennd1c UTSW 17 57066428 nonsense probably null
R4987:Dennd1c UTSW 17 57073852 missense probably damaging 0.98
R5417:Dennd1c UTSW 17 57066755 frame shift probably null
R5418:Dennd1c UTSW 17 57066755 frame shift probably null
R6241:Dennd1c UTSW 17 57066272 missense probably benign 0.00
R6722:Dennd1c UTSW 17 57066802 missense probably benign
R7099:Dennd1c UTSW 17 57067915 critical splice donor site probably null
R7491:Dennd1c UTSW 17 57072379 missense probably damaging 1.00
R7595:Dennd1c UTSW 17 57071633 missense probably damaging 1.00
R8081:Dennd1c UTSW 17 57074139 missense possibly damaging 0.94
R8198:Dennd1c UTSW 17 57066460 missense possibly damaging 0.84
Z1177:Dennd1c UTSW 17 57074330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGAAAGCTGCCATCTAGAG -3'
(R):5'- TCATCCAGGACTTGAACTTGC -3'

Sequencing Primer
(F):5'- ATCTAGAGTATCTTCTGCCCAGGG -3'
(R):5'- TTGAACTTGCAAACAATCCTCCTG -3'
Posted On2018-03-15