Incidental Mutation 'R6260:Trdmt1'
ID506600
Institutional Source Beutler Lab
Gene Symbol Trdmt1
Ensembl Gene ENSMUSG00000026723
Gene NametRNA aspartic acid methyltransferase 1
SynonymsRnmt2, Dnmt2
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location13509014-13544668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13520059 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 195 (Q195L)
Ref Sequence ENSEMBL: ENSMUSP00000114572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124488] [ENSMUST00000144957]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028055
Predicted Effect probably benign
Transcript: ENSMUST00000124488
AA Change: Q195L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114572
Gene: ENSMUSG00000026723
AA Change: Q195L

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 391 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144957
SMART Domains Protein: ENSMUSP00000141758
Gene: ENSMUSG00000026723

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 84 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased proportion of natural killer cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Trdmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Trdmt1 APN 2 13521260 splice site probably null
IGL01584:Trdmt1 APN 2 13519928 missense probably benign 0.00
IGL02491:Trdmt1 APN 2 13516672 missense probably benign 0.17
IGL03025:Trdmt1 APN 2 13523435 missense probably damaging 0.98
R0167:Trdmt1 UTSW 2 13516018 missense probably damaging 1.00
R0193:Trdmt1 UTSW 2 13544617 missense probably damaging 1.00
R0638:Trdmt1 UTSW 2 13516648 splice site probably benign
R0690:Trdmt1 UTSW 2 13544580 missense probably benign 0.01
R0735:Trdmt1 UTSW 2 13523438 missense probably benign 0.23
R1102:Trdmt1 UTSW 2 13523414 splice site probably benign
R1432:Trdmt1 UTSW 2 13519846 missense probably damaging 0.98
R1610:Trdmt1 UTSW 2 13516059 missense probably damaging 1.00
R1935:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R1936:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R2060:Trdmt1 UTSW 2 13519914 missense probably benign 0.01
R2231:Trdmt1 UTSW 2 13525625 missense probably damaging 1.00
R2339:Trdmt1 UTSW 2 13520060 nonsense probably null
R3703:Trdmt1 UTSW 2 13521297 missense probably benign 0.16
R3735:Trdmt1 UTSW 2 13519873 missense possibly damaging 0.51
R4751:Trdmt1 UTSW 2 13544653 utr 5 prime probably benign
R6258:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6799:Trdmt1 UTSW 2 13516013 critical splice donor site probably null
R7329:Trdmt1 UTSW 2 13516122 missense probably damaging 1.00
R8126:Trdmt1 UTSW 2 13520005 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCAGCATCTGCACAGAGAG -3'
(R):5'- TGACTGGATGACTGCTAGCTTC -3'

Sequencing Primer
(F):5'- ATCTGCACAGAGAGGTCACTGTC -3'
(R):5'- GACTGCTAGCTTCTGACAATAAC -3'
Posted On2018-03-15