Mutagenetix > Incidental Mutations

Incidental Mutation 'R6260:Sord'

506604

Institutional Source

Beutler Lab

Gene Symbol

Sord

Ensembl Gene

ENSMUSG00000027227

Gene Name

sorbitol dehydrogenase

Synonyms

Sodh-1, Sdh1, Sdh-1

MMRRC Submission

044377-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122234749-122265340 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 122259132 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110551]

Predicted Effect

probably null
Transcript: ENSMUST00000110551

SMART Domains

Protein: ENSMUSP00000106180
Gene: ENSMUSG00000027227

Domain	Start	End	E-Value	Type
Pfam:ADH_N	32	143	1.3e-24	PFAM
Pfam:Glu_dehyd_C	149	349	5.1e-12	PFAM
Pfam:AlaDh_PNT_C	161	242	6e-8	PFAM
Pfam:ADH_zinc_N	183	313	3.1e-25	PFAM

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]). The first reaction of the pathway (also called the polyol pathway) is the reduction of glucose to sorbitol by ALDR1 with NADPH as the cofactor. SORD then oxidizes the sorbitol to fructose using NAD(+) cofactor.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a functional null allele found in strain C57BL/LiA exhibit no obvious abnormalities in the kidney or other physiological systems. An additional isoelectric focusing variant is found in Peru stocks and has about 25% of the activity of that in most inbred strains. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,008,987	N1514K	probably damaging	Het
Abcb4	G	T	5: 8,934,219	G650*	probably null	Het
Acsbg1	T	A	9: 54,628,467		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
Ank2	C	T	3: 126,943,557	V2806I	probably benign	Het
Atxn10	A	T	15: 85,462,411	I457F	probably benign	Het
Cad	G	T	5: 31,066,800	M800I	probably null	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Ccz1	A	G	5: 144,004,041		probably null	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Cfap52	A	T	11: 67,938,954	C330S	possibly damaging	Het
Clec16a	C	T	16: 10,694,848		probably benign	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddhd2	A	G	8: 25,752,117	F244L	probably benign	Het
Ddn	A	G	15: 98,805,854	V519A	possibly damaging	Het
Dip2b	G	T	15: 100,162,702	V253L	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Foxd4	A	G	19: 24,899,604	S411P	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Galntl6	T	A	8: 57,884,481	D135V	probably damaging	Het
Gm1043	G	C	5: 37,174,472	G832A	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm21103	C	T	14: 6,303,847	E68K	probably damaging	Het
Gm340	A	T	19: 41,582,370	S1C	probably null	Het
Gm340	G	T	19: 41,582,371	S1I	possibly damaging	Het
Gpam	A	G	19: 55,083,406	V301A	probably benign	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jak3	C	A	8: 71,679,310	Q177K	probably benign	Het
Kcnu1	G	A	8: 25,851,891	R88H	probably damaging	Het
Kng1	A	T	16: 23,058,621	I60F	possibly damaging	Het
Krt77	A	T	15: 101,864,372	Y257*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mefv	C	T	16: 3,713,034	R498H	probably benign	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Mtcl1	T	A	17: 66,343,541	Q1340L	probably damaging	Het
Nfic	A	T	10: 81,420,517	C126*	probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr694	A	T	7: 106,688,872	N286K	probably damaging	Het
Olfr808	C	A	10: 129,767,520	T8K	probably benign	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Plxnb2	A	T	15: 89,165,291	I575N	probably benign	Het
Pnmal2	T	G	7: 16,946,233	W381G	probably benign	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rwdd2b	C	A	16: 87,434,468	G266V	probably damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
St8sia2	T	A	7: 73,976,693	R42S	possibly damaging	Het
Syt9	G	T	7: 107,436,510	V245F	possibly damaging	Het
Tbpl2	T	A	2: 24,094,886	N82I	possibly damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Timm13	A	C	10: 80,900,301		probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ttc27	T	A	17: 74,858,091	V764D	probably damaging	Het
Ttc39d	C	A	17: 80,216,647	S245*	probably null	Het
Ttc41	A	G	10: 86,731,159	E563G	probably benign	Het
Ttc41	A	T	10: 86,733,707	T650S	probably benign	Het
U2surp	A	C	9: 95,476,157	L723R	probably damaging	Het
Ubqln3	G	A	7: 104,142,317	Q189*	probably null	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Vmn2r79	T	A	7: 87,037,157	M582K	probably benign	Het
Zfp518a	A	G	19: 40,914,123	D832G	probably benign	Het
Zfyve28	T	C	5: 34,198,872	N762D	probably damaging	Het

Other mutations in Sord

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Sord	APN	2	122264083	missense	probably benign	0.28
R6015:Sord	UTSW	2	122256943	missense	probably damaging	1.00
R6258:Sord	UTSW	2	122259132	critical splice donor site	probably null
R6417:Sord	UTSW	2	122264121	missense	possibly damaging	0.93
R6420:Sord	UTSW	2	122264121	missense	possibly damaging	0.93
R6940:Sord	UTSW	2	122264055	missense	probably damaging	0.99
R7800:Sord	UTSW	2	122259080	missense	probably damaging	0.97
R7903:Sord	UTSW	2	122263225	missense	probably benign	0.02
R8369:Sord	UTSW	2	122246495	missense	probably benign	0.01
R8520:Sord	UTSW	2	122256942	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- CCAGGCAATTGCATAGACACTAG -3'
(R):5'- AGAACGAGGCCAGCTGTTTC -3'

Sequencing Primer
(F):5'- TTGCATAGACACTAGCAACACATG -3'
(R):5'- CAGATGTGGTAGCCATGCCTTTAATC -3'

Posted On

2018-03-15