Incidental Mutation 'R6260:Ank2'
ID506607
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Nameankyrin 2, brain
SynonymsAnkyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location126921612-127499350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126943557 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2806 (V2806I)
Ref Sequence ENSEMBL: ENSMUSP00000138753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078]
Predicted Effect probably benign
Transcript: ENSMUST00000044443
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182025
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect probably benign
Transcript: ENSMUST00000182064
AA Change: V2893I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: V2893I

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182078
AA Change: V2806I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: V2806I

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
ballast UTSW 3 126943133 missense unknown
Chain UTSW 3 126946938 intron probably benign
drag UTSW 3 127003982 missense probably damaging 1.00
mooring UTSW 3 126934577 missense possibly damaging 0.73
Windlass UTSW 3 126946149 missense probably benign
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1775:Ank2 UTSW 3 126934547 missense probably benign 0.00
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4946:Ank2 UTSW 3 126941940 intron probably benign
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 splice site probably null
R5175:Ank2 UTSW 3 127004024 missense probably damaging 1.00
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6393:Ank2 UTSW 3 126929757 missense probably damaging 1.00
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
R7175:Ank2 UTSW 3 126946941 missense unknown
R7191:Ank2 UTSW 3 126946392 missense unknown
R7272:Ank2 UTSW 3 126943133 missense unknown
R7381:Ank2 UTSW 3 126936628 missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126936653 missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126943034 missense unknown
R7490:Ank2 UTSW 3 126958889 missense probably damaging 0.99
R7514:Ank2 UTSW 3 127025603 missense probably benign 0.06
R7534:Ank2 UTSW 3 126934333 splice site probably null
R7540:Ank2 UTSW 3 126988159 missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126945203 missense unknown
R7579:Ank2 UTSW 3 126946398 missense unknown
R7584:Ank2 UTSW 3 126946128 nonsense probably null
R7625:Ank2 UTSW 3 127052800 missense probably damaging 1.00
R7698:Ank2 UTSW 3 127032211 missense probably benign 0.35
R7716:Ank2 UTSW 3 126943166 missense unknown
R7718:Ank2 UTSW 3 126965013 missense possibly damaging 0.88
R7722:Ank2 UTSW 3 127029302 missense probably benign 0.01
R7738:Ank2 UTSW 3 126947622 missense
R7977:Ank2 UTSW 3 126945707 missense unknown
R7987:Ank2 UTSW 3 126945707 missense unknown
R8007:Ank2 UTSW 3 126936447 intron probably benign
R8150:Ank2 UTSW 3 126947513 missense
R8161:Ank2 UTSW 3 127032129 missense
R8196:Ank2 UTSW 3 126929883 missense probably damaging 0.99
R8248:Ank2 UTSW 3 126937785 missense possibly damaging 0.78
R8255:Ank2 UTSW 3 126946749 missense unknown
R8279:Ank2 UTSW 3 126933171 missense probably benign 0.04
R8300:Ank2 UTSW 3 127010906 missense
RF020:Ank2 UTSW 3 126945476 missense unknown
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126944357 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCACTACCACATCCTCAGGAG -3'
(R):5'- AGATCTTCCCAATGAAAGCTCTTC -3'

Sequencing Primer
(F):5'- CTCAGGAGAGGATCTGATGATGAC -3'
(R):5'- CCAATGAAAGCTCTTCCTTGTC -3'
Posted On2018-03-15