Mutagenetix > Incidental Mutation

Incidental Mutation 'R6260:Plin2'

506608

Institutional Source

Beutler Lab

Gene Symbol

Plin2

Ensembl Gene

ENSMUSG00000028494

Gene Name

perilipin 2

Synonyms

adipophilin, Adrp, Adfp, ADPH

MMRRC Submission

044377-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R6260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86648386-86670060 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86657289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 341 (A341D)

Ref Sequence

ENSEMBL: ENSMUSP00000000466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]

AlphaFold

P43883

Predicted Effect

probably damaging
Transcript: ENSMUST00000000466
AA Change: A341D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: A341D

Domain	Start	End	E-Value	Type
Pfam:Perilipin	6	393	5.3e-158	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138605

Predicted Effect

probably benign
Transcript: ENSMUST00000140382

SMART Domains

Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494

Domain	Start	End	E-Value	Type
Pfam:Perilipin	1	196	5.2e-83	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147097

SMART Domains

Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494

Domain	Start	End	E-Value	Type
Pfam:Perilipin	1	157	3.1e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149700

SMART Domains

Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494

Domain	Start	End	E-Value	Type
Pfam:Perilipin	1	196	5.2e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154999

Meta Mutation Damage Score

0.6030

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,008,987	N1514K	probably damaging	Het
Abcb4	G	T	5: 8,934,219	G650*	probably null	Het
Acsbg1	T	A	9: 54,628,467		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
Ank2	C	T	3: 126,943,557	V2806I	probably benign	Het
Atxn10	A	T	15: 85,462,411	I457F	probably benign	Het
Cad	G	T	5: 31,066,800	M800I	probably null	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Ccz1	A	G	5: 144,004,041		probably null	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Cfap52	A	T	11: 67,938,954	C330S	possibly damaging	Het
Clec16a	C	T	16: 10,694,848		probably benign	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddhd2	A	G	8: 25,752,117	F244L	probably benign	Het
Ddn	A	G	15: 98,805,854	V519A	possibly damaging	Het
Dip2b	G	T	15: 100,162,702	V253L	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Foxd4	A	G	19: 24,899,604	S411P	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Galntl6	T	A	8: 57,884,481	D135V	probably damaging	Het
Gm1043	G	C	5: 37,174,472	G832A	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm21103	C	T	14: 6,303,847	E68K	probably damaging	Het
Gm340	A	T	19: 41,582,370	S1C	probably null	Het
Gm340	G	T	19: 41,582,371	S1I	possibly damaging	Het
Gpam	A	G	19: 55,083,406	V301A	probably benign	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jak3	C	A	8: 71,679,310	Q177K	probably benign	Het
Kcnu1	G	A	8: 25,851,891	R88H	probably damaging	Het
Kng1	A	T	16: 23,058,621	I60F	possibly damaging	Het
Krt77	A	T	15: 101,864,372	Y257*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mefv	C	T	16: 3,713,034	R498H	probably benign	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Mtcl1	T	A	17: 66,343,541	Q1340L	probably damaging	Het
Nfic	A	T	10: 81,420,517	C126*	probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr694	A	T	7: 106,688,872	N286K	probably damaging	Het
Olfr808	C	A	10: 129,767,520	T8K	probably benign	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plxnb2	A	T	15: 89,165,291	I575N	probably benign	Het
Pnmal2	T	G	7: 16,946,233	W381G	probably benign	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rwdd2b	C	A	16: 87,434,468	G266V	probably damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
St8sia2	T	A	7: 73,976,693	R42S	possibly damaging	Het
Syt9	G	T	7: 107,436,510	V245F	possibly damaging	Het
Tbpl2	T	A	2: 24,094,886	N82I	possibly damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Timm13	A	C	10: 80,900,301		probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ttc27	T	A	17: 74,858,091	V764D	probably damaging	Het
Ttc39d	C	A	17: 80,216,647	S245*	probably null	Het
Ttc41	A	G	10: 86,731,159	E563G	probably benign	Het
Ttc41	A	T	10: 86,733,707	T650S	probably benign	Het
U2surp	A	C	9: 95,476,157	L723R	probably damaging	Het
Ubqln3	G	A	7: 104,142,317	Q189*	probably null	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Vmn2r79	T	A	7: 87,037,157	M582K	probably benign	Het
Zfp518a	A	G	19: 40,914,123	D832G	probably benign	Het
Zfyve28	T	C	5: 34,198,872	N762D	probably damaging	Het

Other mutations in Plin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00826:Plin2	APN	4	86664446	missense	possibly damaging	0.88
IGL02501:Plin2	APN	4	86664486	nonsense	probably null
IGL02551:Plin2	APN	4	86658692	missense	probably benign	0.00
IGL03294:Plin2	APN	4	86662078	missense	probably damaging	0.96
R1484:Plin2	UTSW	4	86657244	missense	probably benign	0.00
R2165:Plin2	UTSW	4	86668432	missense	probably damaging	1.00
R2870:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2870:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2871:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2871:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2872:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2872:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R2873:Plin2	UTSW	4	86668678	start codon destroyed	probably null	0.99
R3125:Plin2	UTSW	4	86657144	nonsense	probably null
R4948:Plin2	UTSW	4	86661991	missense	probably benign	0.00
R5189:Plin2	UTSW	4	86657146	missense	probably damaging	1.00
R5563:Plin2	UTSW	4	86662104	missense	probably benign	0.01
R6229:Plin2	UTSW	4	86668666	missense	probably benign
R6258:Plin2	UTSW	4	86657289	missense	probably damaging	0.97
R6391:Plin2	UTSW	4	86661999	missense	probably null	0.99
R6470:Plin2	UTSW	4	86668370	missense	probably damaging	1.00
R6493:Plin2	UTSW	4	86661987	missense	possibly damaging	0.80
R6562:Plin2	UTSW	4	86658595	missense	probably benign	0.07
R6706:Plin2	UTSW	4	86660120	missense	probably benign	0.02
R7310:Plin2	UTSW	4	86668391	missense	probably benign	0.03
R8057:Plin2	UTSW	4	86657401	missense	possibly damaging	0.80
R8171:Plin2	UTSW	4	86657112	missense	probably damaging	0.99
R9003:Plin2	UTSW	4	86662087	missense	probably benign	0.08
R9041:Plin2	UTSW	4	86660267	missense	probably benign
R9789:Plin2	UTSW	4	86658677	missense	probably damaging	1.00
R9800:Plin2	UTSW	4	86668505	missense	possibly damaging	0.78
U24488:Plin2	UTSW	4	86662077	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGCTGGCCTTGTTCAC -3'
(R):5'- GGGCTCAATCATACACAGCG -3'

Sequencing Primer
(F):5'- GTTCACCTCGGTAGACTGAG -3'
(R):5'- TACACAGCGCCTTCGGATC -3'

Posted On

2018-03-15