Mutagenetix > Incidental Mutation

Incidental Mutation 'R6260:Abcb4'

506610

Institutional Source

Beutler Lab

Gene Symbol

Abcb4

Ensembl Gene

ENSMUSG00000042476

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 4

Synonyms

Pgy-2, Mdr2, Pgy2, mdr-2

MMRRC Submission

044377-MU

Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8893717-8959231 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 8934219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 650 (G650*)

Ref Sequence

ENSEMBL: ENSMUSP00000142425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]

AlphaFold

P21440

Predicted Effect

probably null
Transcript: ENSMUST00000003717
AA Change: G650*

SMART Domains

Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: G650*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	342	2e-94	PFAM
AAA	418	610	3.97e-20	SMART
Pfam:ABC_membrane	708	982	6.3e-77	PFAM
AAA	1058	1246	4.49e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196067
AA Change: G650*

SMART Domains

Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: G650*

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	344	2.4e-95	PFAM
AAA	418	610	6.2e-22	SMART
Pfam:ABC_membrane	708	882	1.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199954

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,008,987	N1514K	probably damaging	Het
Acsbg1	T	A	9: 54,628,467		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
Ank2	C	T	3: 126,943,557	V2806I	probably benign	Het
Atxn10	A	T	15: 85,462,411	I457F	probably benign	Het
Cad	G	T	5: 31,066,800	M800I	probably null	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Ccz1	A	G	5: 144,004,041		probably null	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Cfap52	A	T	11: 67,938,954	C330S	possibly damaging	Het
Clec16a	C	T	16: 10,694,848		probably benign	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddhd2	A	G	8: 25,752,117	F244L	probably benign	Het
Ddn	A	G	15: 98,805,854	V519A	possibly damaging	Het
Dip2b	G	T	15: 100,162,702	V253L	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Foxd4	A	G	19: 24,899,604	S411P	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Galntl6	T	A	8: 57,884,481	D135V	probably damaging	Het
Gm1043	G	C	5: 37,174,472	G832A	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm21103	C	T	14: 6,303,847	E68K	probably damaging	Het
Gm340	A	T	19: 41,582,370	S1C	probably null	Het
Gm340	G	T	19: 41,582,371	S1I	possibly damaging	Het
Gpam	A	G	19: 55,083,406	V301A	probably benign	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jak3	C	A	8: 71,679,310	Q177K	probably benign	Het
Kcnu1	G	A	8: 25,851,891	R88H	probably damaging	Het
Kng1	A	T	16: 23,058,621	I60F	possibly damaging	Het
Krt77	A	T	15: 101,864,372	Y257*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mefv	C	T	16: 3,713,034	R498H	probably benign	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Mtcl1	T	A	17: 66,343,541	Q1340L	probably damaging	Het
Nfic	A	T	10: 81,420,517	C126*	probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr694	A	T	7: 106,688,872	N286K	probably damaging	Het
Olfr808	C	A	10: 129,767,520	T8K	probably benign	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Plxnb2	A	T	15: 89,165,291	I575N	probably benign	Het
Pnmal2	T	G	7: 16,946,233	W381G	probably benign	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rwdd2b	C	A	16: 87,434,468	G266V	probably damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
St8sia2	T	A	7: 73,976,693	R42S	possibly damaging	Het
Syt9	G	T	7: 107,436,510	V245F	possibly damaging	Het
Tbpl2	T	A	2: 24,094,886	N82I	possibly damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Timm13	A	C	10: 80,900,301		probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ttc27	T	A	17: 74,858,091	V764D	probably damaging	Het
Ttc39d	C	A	17: 80,216,647	S245*	probably null	Het
Ttc41	A	G	10: 86,731,159	E563G	probably benign	Het
Ttc41	A	T	10: 86,733,707	T650S	probably benign	Het
U2surp	A	C	9: 95,476,157	L723R	probably damaging	Het
Ubqln3	G	A	7: 104,142,317	Q189*	probably null	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Vmn2r79	T	A	7: 87,037,157	M582K	probably benign	Het
Zfp518a	A	G	19: 40,914,123	D832G	probably benign	Het
Zfyve28	T	C	5: 34,198,872	N762D	probably damaging	Het

Other mutations in Abcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Abcb4	APN	5	8950073	missense	probably benign	0.02
IGL00663:Abcb4	APN	5	8927916	missense	probably damaging	1.00
IGL00671:Abcb4	APN	5	8930745	nonsense	probably null
IGL00822:Abcb4	APN	5	8950046	missense	probably benign
IGL01080:Abcb4	APN	5	8934258	missense	probably damaging	1.00
IGL01152:Abcb4	APN	5	8950678	missense	probably benign	0.19
IGL01329:Abcb4	APN	5	8894166	critical splice donor site	probably null
IGL01483:Abcb4	APN	5	8927871	missense	probably damaging	0.99
IGL01594:Abcb4	APN	5	8946071	splice site	probably null
IGL01785:Abcb4	APN	5	8915058	nonsense	probably null
IGL01968:Abcb4	APN	5	8927913	missense	probably benign	0.33
IGL02579:Abcb4	APN	5	8955537	missense	probably damaging	1.00
IGL02654:Abcb4	APN	5	8927826	missense	possibly damaging	0.80
IGL02658:Abcb4	APN	5	8934240	missense	probably benign
IGL03229:Abcb4	APN	5	8940936	missense	probably damaging	0.97
IGL03335:Abcb4	APN	5	8935258	missense	probably benign	0.00
FR4737:Abcb4	UTSW	5	8896597	small deletion	probably benign
P0014:Abcb4	UTSW	5	8950083	missense	probably benign	0.01
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0309:Abcb4	UTSW	5	8939835	missense	probably damaging	1.00
R0311:Abcb4	UTSW	5	8934243	missense	probably benign
R0420:Abcb4	UTSW	5	8941050	missense	probably benign	0.03
R0449:Abcb4	UTSW	5	8939885	nonsense	probably null
R0609:Abcb4	UTSW	5	8947376	missense	probably damaging	0.96
R1459:Abcb4	UTSW	5	8918662	missense	possibly damaging	0.61
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1812:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R1944:Abcb4	UTSW	5	8930796	missense	probably damaging	1.00
R2002:Abcb4	UTSW	5	8905989	missense	probably benign	0.01
R2256:Abcb4	UTSW	5	8958431	missense	probably damaging	1.00
R3116:Abcb4	UTSW	5	8896610	missense	possibly damaging	0.86
R4112:Abcb4	UTSW	5	8936783	critical splice acceptor site	probably null
R4354:Abcb4	UTSW	5	8918771	missense	probably benign	0.44
R4512:Abcb4	UTSW	5	8928573	missense	probably damaging	1.00
R4588:Abcb4	UTSW	5	8947328	missense	probably benign	0.01
R4628:Abcb4	UTSW	5	8907399	missense	probably benign	0.08
R4708:Abcb4	UTSW	5	8915125	missense	possibly damaging	0.90
R4714:Abcb4	UTSW	5	8930906	splice site	probably null
R4754:Abcb4	UTSW	5	8910717	missense	probably damaging	1.00
R4846:Abcb4	UTSW	5	8935180	missense	probably benign
R4896:Abcb4	UTSW	5	8907267	missense	possibly damaging	0.81
R4944:Abcb4	UTSW	5	8934327	critical splice donor site	probably null
R4994:Abcb4	UTSW	5	8928524	missense	probably damaging	1.00
R5022:Abcb4	UTSW	5	8909054	splice site	probably null
R5537:Abcb4	UTSW	5	8955485	missense	probably damaging	0.98
R5754:Abcb4	UTSW	5	8934320	missense	probably benign
R5833:Abcb4	UTSW	5	8958314	missense	probably damaging	1.00
R5934:Abcb4	UTSW	5	8930806	missense	probably benign	0.18
R6006:Abcb4	UTSW	5	8946026	missense	probably damaging	0.99
R6146:Abcb4	UTSW	5	8896587	missense	probably benign	0.05
R6183:Abcb4	UTSW	5	8918718	missense	probably benign
R6561:Abcb4	UTSW	5	8927825	missense	probably benign	0.14
R7016:Abcb4	UTSW	5	8936843	missense	probably benign	0.35
R7081:Abcb4	UTSW	5	8934263	missense	probably benign
R7326:Abcb4	UTSW	5	8934226	missense	probably benign	0.00
R7375:Abcb4	UTSW	5	8918671	missense	probably benign
R7787:Abcb4	UTSW	5	8909220	missense	probably damaging	1.00
R7836:Abcb4	UTSW	5	8934203	missense	probably benign
R8128:Abcb4	UTSW	5	8958395	missense	probably damaging	1.00
R8350:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R8438:Abcb4	UTSW	5	8946120	critical splice donor site	probably null
R8447:Abcb4	UTSW	5	8907278	missense	probably damaging	0.97
R8710:Abcb4	UTSW	5	8955495	missense	probably damaging	1.00
R8777:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8777-TAIL:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8837:Abcb4	UTSW	5	8936873	missense	probably damaging	0.99
R8987:Abcb4	UTSW	5	8927931	missense	probably benign	0.02
R9098:Abcb4	UTSW	5	8958441	missense	probably damaging	1.00
R9167:Abcb4	UTSW	5	8936849	nonsense	probably null
R9210:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9212:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9218:Abcb4	UTSW	5	8927960	missense	probably benign	0.20
R9242:Abcb4	UTSW	5	8899677	missense	probably damaging	1.00
R9376:Abcb4	UTSW	5	8958988	missense	probably damaging	1.00
R9476:Abcb4	UTSW	5	8927790	missense	probably damaging	1.00
RF015:Abcb4	UTSW	5	8896594	frame shift	probably null
RF047:Abcb4	UTSW	5	8896595	frame shift	probably null
Z1176:Abcb4	UTSW	5	8959005	missense	probably damaging	1.00
Z1177:Abcb4	UTSW	5	8939906	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGTCCTGTCCTTGATTTCAAACC -3'
(R):5'- AGTCATGTGCTCTTTAGGGC -3'

Sequencing Primer
(F):5'- GTCCTTGATTTCAAACCTCAACCTAG -3'
(R):5'- GGCTAAAGATTTCAGTAGCAAAACTC -3'

Posted On

2018-03-15