Mutagenetix > Incidental Mutations

Incidental Mutation 'R6260:Ubqln3'

506622

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

044377-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R6260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 104142317 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 189 (Q189*)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

Predicted Effect

probably null
Transcript: ENSMUST00000057254
AA Change: Q189*

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Q189*

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.9718

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,008,987	N1514K	probably damaging	Het
Abcb4	G	T	5: 8,934,219	G650*	probably null	Het
Acsbg1	T	A	9: 54,628,467		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
Ank2	C	T	3: 126,943,557	V2806I	probably benign	Het
Atxn10	A	T	15: 85,462,411	I457F	probably benign	Het
Cad	G	T	5: 31,066,800	M800I	probably null	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Ccz1	A	G	5: 144,004,041		probably null	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Cfap52	A	T	11: 67,938,954	C330S	possibly damaging	Het
Clec16a	C	T	16: 10,694,848		probably benign	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddhd2	A	G	8: 25,752,117	F244L	probably benign	Het
Ddn	A	G	15: 98,805,854	V519A	possibly damaging	Het
Dip2b	G	T	15: 100,162,702	V253L	probably benign	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Foxd4	A	G	19: 24,899,604	S411P	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Galntl6	T	A	8: 57,884,481	D135V	probably damaging	Het
Gm1043	G	C	5: 37,174,472	G832A	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm21103	C	T	14: 6,303,847	E68K	probably damaging	Het
Gm340	A	T	19: 41,582,370	S1C	probably null	Het
Gm340	G	T	19: 41,582,371	S1I	possibly damaging	Het
Gpam	A	G	19: 55,083,406	V301A	probably benign	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jak3	C	A	8: 71,679,310	Q177K	probably benign	Het
Kcnu1	G	A	8: 25,851,891	R88H	probably damaging	Het
Kng1	A	T	16: 23,058,621	I60F	possibly damaging	Het
Krt77	A	T	15: 101,864,372	Y257*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mefv	C	T	16: 3,713,034	R498H	probably benign	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Mtcl1	T	A	17: 66,343,541	Q1340L	probably damaging	Het
Nfic	A	T	10: 81,420,517	C126*	probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr694	A	T	7: 106,688,872	N286K	probably damaging	Het
Olfr808	C	A	10: 129,767,520	T8K	probably benign	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Pla2g4a	A	G	1: 149,857,487	S504P	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Plxnb2	A	T	15: 89,165,291	I575N	probably benign	Het
Pnmal2	T	G	7: 16,946,233	W381G	probably benign	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rwdd2b	C	A	16: 87,434,468	G266V	probably damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
St8sia2	T	A	7: 73,976,693	R42S	possibly damaging	Het
Syt9	G	T	7: 107,436,510	V245F	possibly damaging	Het
Tbpl2	T	A	2: 24,094,886	N82I	possibly damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Timm13	A	C	10: 80,900,301		probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ttc27	T	A	17: 74,858,091	V764D	probably damaging	Het
Ttc39d	C	A	17: 80,216,647	S245*	probably null	Het
Ttc41	A	G	10: 86,731,159	E563G	probably benign	Het
Ttc41	A	T	10: 86,733,707	T650S	probably benign	Het
U2surp	A	C	9: 95,476,157	L723R	probably damaging	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Vmn2r79	T	A	7: 87,037,157	M582K	probably benign	Het
Zfp518a	A	G	19: 40,914,123	D832G	probably benign	Het
Zfyve28	T	C	5: 34,198,872	N762D	probably damaging	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGTGTACATAGTACGGAGCAC -3'
(R):5'- GGATGGGTCTCCTTCTTTCAGC -3'

Sequencing Primer
(F):5'- TACGGAGCACATTGTAGCC -3'
(R):5'- TTCAGCTTAGGGGTCCTCACAG -3'

Posted On

2018-03-15