Incidental Mutation 'R6260:Ttc41'
ID 506634
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 044377-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R6260 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86567023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 563 (E563G)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: E563G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: E563G

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: E563G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,844,821 (GRCm39) N1514K probably damaging Het
Abcb4 G T 5: 8,984,219 (GRCm39) G650* probably null Het
Acsbg1 T A 9: 54,535,751 (GRCm39) probably null Het
Alms1 A T 6: 85,605,717 (GRCm39) K2456* probably null Het
Alppl2 A T 1: 87,016,184 (GRCm39) M225K probably damaging Het
Ank2 C T 3: 126,737,206 (GRCm39) V2806I probably benign Het
Atxn10 A T 15: 85,346,612 (GRCm39) I457F probably benign Het
Cad G T 5: 31,224,144 (GRCm39) M800I probably null Het
Carmil3 T A 14: 55,737,889 (GRCm39) L815Q probably damaging Het
Ccz1 A G 5: 143,940,859 (GRCm39) probably null Het
Cdc73 G A 1: 143,567,211 (GRCm39) T104I probably benign Het
Cfap52 A T 11: 67,829,780 (GRCm39) C330S possibly damaging Het
Clec16a C T 16: 10,512,712 (GRCm39) probably benign Het
Cntn3 A G 6: 102,254,178 (GRCm39) probably null Het
Crocc2 A G 1: 93,141,360 (GRCm39) K1171R possibly damaging Het
Ctsa T C 2: 164,676,281 (GRCm39) V86A probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Ddhd2 A G 8: 26,242,144 (GRCm39) F244L probably benign Het
Ddn A G 15: 98,703,735 (GRCm39) V519A possibly damaging Het
Dip2b G T 15: 100,060,583 (GRCm39) V253L probably benign Het
Dnah17 C A 11: 118,017,148 (GRCm39) W197C probably damaging Het
Dnah17 A T 11: 118,017,150 (GRCm39) W197R probably damaging Het
Dnah17 C T 11: 118,017,149 (GRCm39) W197* probably null Het
Ercc6 T A 14: 32,279,813 (GRCm39) D609E probably benign Het
Erg C A 16: 95,181,100 (GRCm39) R147L probably damaging Het
Fbxo41 A T 6: 85,455,537 (GRCm39) L549H probably damaging Het
Foxd4 A G 19: 24,876,968 (GRCm39) S411P probably benign Het
Gaa C A 11: 119,171,997 (GRCm39) A700D probably benign Het
Galntl6 T A 8: 58,337,515 (GRCm39) D135V probably damaging Het
Gm1043 G C 5: 37,331,816 (GRCm39) G832A probably benign Het
Gm21103 C T 14: 17,484,841 (GRCm39) E68K probably damaging Het
Gpam A G 19: 55,071,838 (GRCm39) V301A probably benign Het
H2-M10.1 T A 17: 36,634,994 (GRCm39) I304F unknown Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Jak3 C A 8: 72,131,954 (GRCm39) Q177K probably benign Het
Kcnu1 G A 8: 26,341,919 (GRCm39) R88H probably damaging Het
Kng1 A T 16: 22,877,371 (GRCm39) I60F possibly damaging Het
Krt77 A T 15: 101,772,807 (GRCm39) Y257* probably null Het
Lcor G T 19: 41,570,810 (GRCm39) S1I possibly damaging Het
Lcor A T 19: 41,570,809 (GRCm39) S1C probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Map4k5 C A 12: 69,878,336 (GRCm39) R355L probably benign Het
Mefv C T 16: 3,530,898 (GRCm39) R498H probably benign Het
Mical3 A T 6: 120,985,991 (GRCm39) L150Q probably damaging Het
Mtcl1 T A 17: 66,650,536 (GRCm39) Q1340L probably damaging Het
Nfic A T 10: 81,256,351 (GRCm39) C126* probably null Het
Nisch T A 14: 30,899,085 (GRCm39) probably benign Het
Nt5dc3 A G 10: 86,647,395 (GRCm39) Y130C probably damaging Het
Or2ag1b A T 7: 106,288,079 (GRCm39) N286K probably damaging Het
Or4f15 C T 2: 111,814,396 (GRCm39) V8I probably benign Het
Or6c65 C A 10: 129,603,389 (GRCm39) T8K probably benign Het
Pcdhb12 T C 18: 37,569,892 (GRCm39) V346A probably benign Het
Pla2g4a A G 1: 149,733,238 (GRCm39) S504P probably benign Het
Plin2 G T 4: 86,575,526 (GRCm39) A341D probably damaging Het
Plxnb2 A T 15: 89,049,494 (GRCm39) I575N probably benign Het
Pnma8b T G 7: 16,680,158 (GRCm39) W381G probably benign Het
Psma8 A G 18: 14,854,324 (GRCm39) D68G probably damaging Het
Rcor3 G A 1: 191,808,559 (GRCm39) H207Y probably benign Het
Rwdd2b C A 16: 87,231,356 (GRCm39) G266V probably damaging Het
Ryr3 A G 2: 112,490,449 (GRCm39) F3795S probably damaging Het
Slc28a2b A T 2: 122,353,963 (GRCm39) I530F probably damaging Het
Sord T A 2: 122,089,613 (GRCm39) probably null Het
Spdl1 T A 11: 34,710,713 (GRCm39) N345I probably damaging Het
St8sia2 T A 7: 73,626,441 (GRCm39) R42S possibly damaging Het
Syt9 G T 7: 107,035,717 (GRCm39) V245F possibly damaging Het
Tbpl2 T A 2: 23,984,898 (GRCm39) N82I possibly damaging Het
Tcerg1 T A 18: 42,686,530 (GRCm39) Y696N probably damaging Het
Thsd7b A G 1: 129,595,655 (GRCm39) T492A probably benign Het
Timm13 A C 10: 80,736,135 (GRCm39) probably benign Het
Trdmt1 T A 2: 13,524,870 (GRCm39) Q195L probably benign Het
Ttc27 T A 17: 75,165,086 (GRCm39) V764D probably damaging Het
Ttc39d C A 17: 80,524,076 (GRCm39) S245* probably null Het
U2surp A C 9: 95,358,210 (GRCm39) L723R probably damaging Het
Ubqln3 G A 7: 103,791,524 (GRCm39) Q189* probably null Het
Vezf1 A G 11: 87,972,326 (GRCm39) N229S probably damaging Het
Vmn2r79 T A 7: 86,686,365 (GRCm39) M582K probably benign Het
Zfp518a A G 19: 40,902,567 (GRCm39) D832G probably benign Het
Zfyve28 T C 5: 34,356,216 (GRCm39) N762D probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGTCCTGCAAGTC -3'
(R):5'- ACTGGGACAAACAAGTCTTGG -3'

Sequencing Primer
(F):5'- CTGACGTGAAGATCGTGGAACTC -3'
(R):5'- TCTTGGAGCCATAAAGGAGGCAC -3'
Posted On 2018-03-15