Incidental Mutation 'R6260:Gaa'
ID506641
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Nameglucosidase, alpha, acid
SynonymsE430018M07Rik
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119267887-119285454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119281171 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 700 (A700D)
Ref Sequence ENSEMBL: ENSMUSP00000101866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106259] [ENSMUST00000132706]
Predicted Effect probably benign
Transcript: ENSMUST00000026666
AA Change: A700D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: A700D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106259
AA Change: A700D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: A700D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138510
Predicted Effect unknown
Transcript: ENSMUST00000143288
AA Change: A176D
SMART Domains Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579
AA Change: A176D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 8 207 2.2e-67 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
Gpam A G 19: 55,083,406 V301A probably benign Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119274960 missense probably benign
IGL00780:Gaa APN 11 119274291 unclassified probably null
IGL00975:Gaa APN 11 119274683 missense possibly damaging 0.93
IGL01354:Gaa APN 11 119270568 missense probably benign 0.18
IGL01572:Gaa APN 11 119284177 missense probably benign
IGL01634:Gaa APN 11 119274076 missense possibly damaging 0.79
IGL01724:Gaa APN 11 119275121 missense possibly damaging 0.65
IGL01889:Gaa APN 11 119278297 missense probably benign 0.03
IGL02052:Gaa APN 11 119284195 missense possibly damaging 0.76
IGL02173:Gaa APN 11 119274913 missense probably damaging 1.00
IGL02261:Gaa APN 11 119281265 makesense probably null
IGL02337:Gaa APN 11 119277603 missense probably damaging 1.00
IGL02625:Gaa APN 11 119274733 missense probably damaging 1.00
IGL02818:Gaa APN 11 119276848 missense probably damaging 0.97
R0135:Gaa UTSW 11 119278890 missense probably benign 0.00
R0280:Gaa UTSW 11 119284547 missense probably damaging 1.00
R0479:Gaa UTSW 11 119281236 missense possibly damaging 0.95
R1130:Gaa UTSW 11 119274683 missense probably damaging 0.97
R1132:Gaa UTSW 11 119285059 missense probably damaging 0.99
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1179:Gaa UTSW 11 119281128 missense probably damaging 0.98
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1475:Gaa UTSW 11 119274316 splice site probably null
R1711:Gaa UTSW 11 119280460 missense probably damaging 1.00
R1817:Gaa UTSW 11 119284498 nonsense probably null
R1828:Gaa UTSW 11 119283272 missense probably damaging 0.99
R2013:Gaa UTSW 11 119284583 unclassified probably null
R2126:Gaa UTSW 11 119270282 nonsense probably null
R2179:Gaa UTSW 11 119275058 critical splice acceptor site probably null
R2496:Gaa UTSW 11 119283705 missense possibly damaging 0.53
R2936:Gaa UTSW 11 119283724 missense probably benign 0.02
R4321:Gaa UTSW 11 119270137 missense probably benign 0.20
R4603:Gaa UTSW 11 119278958 missense probably damaging 1.00
R4849:Gaa UTSW 11 119272987 missense possibly damaging 0.95
R5225:Gaa UTSW 11 119276843 missense probably damaging 1.00
R5643:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R5644:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R6074:Gaa UTSW 11 119284186 missense probably benign 0.07
R6154:Gaa UTSW 11 119278352 missense probably damaging 1.00
R6208:Gaa UTSW 11 119281171 missense probably benign 0.01
R6209:Gaa UTSW 11 119281171 missense probably benign 0.01
R6258:Gaa UTSW 11 119281171 missense probably benign 0.01
R6259:Gaa UTSW 11 119281171 missense probably benign 0.01
R7173:Gaa UTSW 11 119278991 missense probably damaging 1.00
R7211:Gaa UTSW 11 119284204 missense possibly damaging 0.80
R7379:Gaa UTSW 11 119283699 missense probably benign
R8011:Gaa UTSW 11 119272936 missense probably benign 0.00
X0064:Gaa UTSW 11 119274015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACACTTCCTGTTCTAGTG -3'
(R):5'- TGTGAGAACACCCCTAGCAG -3'

Sequencing Primer
(F):5'- GGCAGAAAGGGTTTATTCCATCC -3'
(R):5'- GGAGGGACTTCTCGGGCAC -3'
Posted On2018-03-15