Incidental Mutation 'R6260:Atxn10'
ID 506647
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Name ataxin 10
Synonyms Sca10, TEG-169, Tex169, E46
MMRRC Submission 044377-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6260 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85220446-85347413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85346612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 457 (I457F)
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
AlphaFold P28658
Predicted Effect probably benign
Transcript: ENSMUST00000163242
AA Change: I457F

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541
AA Change: I457F

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,844,821 (GRCm39) N1514K probably damaging Het
Abcb4 G T 5: 8,984,219 (GRCm39) G650* probably null Het
Acsbg1 T A 9: 54,535,751 (GRCm39) probably null Het
Alms1 A T 6: 85,605,717 (GRCm39) K2456* probably null Het
Alppl2 A T 1: 87,016,184 (GRCm39) M225K probably damaging Het
Ank2 C T 3: 126,737,206 (GRCm39) V2806I probably benign Het
Cad G T 5: 31,224,144 (GRCm39) M800I probably null Het
Carmil3 T A 14: 55,737,889 (GRCm39) L815Q probably damaging Het
Ccz1 A G 5: 143,940,859 (GRCm39) probably null Het
Cdc73 G A 1: 143,567,211 (GRCm39) T104I probably benign Het
Cfap52 A T 11: 67,829,780 (GRCm39) C330S possibly damaging Het
Clec16a C T 16: 10,512,712 (GRCm39) probably benign Het
Cntn3 A G 6: 102,254,178 (GRCm39) probably null Het
Crocc2 A G 1: 93,141,360 (GRCm39) K1171R possibly damaging Het
Ctsa T C 2: 164,676,281 (GRCm39) V86A probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Ddhd2 A G 8: 26,242,144 (GRCm39) F244L probably benign Het
Ddn A G 15: 98,703,735 (GRCm39) V519A possibly damaging Het
Dip2b G T 15: 100,060,583 (GRCm39) V253L probably benign Het
Dnah17 C A 11: 118,017,148 (GRCm39) W197C probably damaging Het
Dnah17 A T 11: 118,017,150 (GRCm39) W197R probably damaging Het
Dnah17 C T 11: 118,017,149 (GRCm39) W197* probably null Het
Ercc6 T A 14: 32,279,813 (GRCm39) D609E probably benign Het
Erg C A 16: 95,181,100 (GRCm39) R147L probably damaging Het
Fbxo41 A T 6: 85,455,537 (GRCm39) L549H probably damaging Het
Foxd4 A G 19: 24,876,968 (GRCm39) S411P probably benign Het
Gaa C A 11: 119,171,997 (GRCm39) A700D probably benign Het
Galntl6 T A 8: 58,337,515 (GRCm39) D135V probably damaging Het
Gm1043 G C 5: 37,331,816 (GRCm39) G832A probably benign Het
Gm21103 C T 14: 17,484,841 (GRCm39) E68K probably damaging Het
Gpam A G 19: 55,071,838 (GRCm39) V301A probably benign Het
H2-M10.1 T A 17: 36,634,994 (GRCm39) I304F unknown Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Jak3 C A 8: 72,131,954 (GRCm39) Q177K probably benign Het
Kcnu1 G A 8: 26,341,919 (GRCm39) R88H probably damaging Het
Kng1 A T 16: 22,877,371 (GRCm39) I60F possibly damaging Het
Krt77 A T 15: 101,772,807 (GRCm39) Y257* probably null Het
Lcor G T 19: 41,570,810 (GRCm39) S1I possibly damaging Het
Lcor A T 19: 41,570,809 (GRCm39) S1C probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Map4k5 C A 12: 69,878,336 (GRCm39) R355L probably benign Het
Mefv C T 16: 3,530,898 (GRCm39) R498H probably benign Het
Mical3 A T 6: 120,985,991 (GRCm39) L150Q probably damaging Het
Mtcl1 T A 17: 66,650,536 (GRCm39) Q1340L probably damaging Het
Nfic A T 10: 81,256,351 (GRCm39) C126* probably null Het
Nisch T A 14: 30,899,085 (GRCm39) probably benign Het
Nt5dc3 A G 10: 86,647,395 (GRCm39) Y130C probably damaging Het
Or2ag1b A T 7: 106,288,079 (GRCm39) N286K probably damaging Het
Or4f15 C T 2: 111,814,396 (GRCm39) V8I probably benign Het
Or6c65 C A 10: 129,603,389 (GRCm39) T8K probably benign Het
Pcdhb12 T C 18: 37,569,892 (GRCm39) V346A probably benign Het
Pla2g4a A G 1: 149,733,238 (GRCm39) S504P probably benign Het
Plin2 G T 4: 86,575,526 (GRCm39) A341D probably damaging Het
Plxnb2 A T 15: 89,049,494 (GRCm39) I575N probably benign Het
Pnma8b T G 7: 16,680,158 (GRCm39) W381G probably benign Het
Psma8 A G 18: 14,854,324 (GRCm39) D68G probably damaging Het
Rcor3 G A 1: 191,808,559 (GRCm39) H207Y probably benign Het
Rwdd2b C A 16: 87,231,356 (GRCm39) G266V probably damaging Het
Ryr3 A G 2: 112,490,449 (GRCm39) F3795S probably damaging Het
Slc28a2b A T 2: 122,353,963 (GRCm39) I530F probably damaging Het
Sord T A 2: 122,089,613 (GRCm39) probably null Het
Spdl1 T A 11: 34,710,713 (GRCm39) N345I probably damaging Het
St8sia2 T A 7: 73,626,441 (GRCm39) R42S possibly damaging Het
Syt9 G T 7: 107,035,717 (GRCm39) V245F possibly damaging Het
Tbpl2 T A 2: 23,984,898 (GRCm39) N82I possibly damaging Het
Tcerg1 T A 18: 42,686,530 (GRCm39) Y696N probably damaging Het
Thsd7b A G 1: 129,595,655 (GRCm39) T492A probably benign Het
Timm13 A C 10: 80,736,135 (GRCm39) probably benign Het
Trdmt1 T A 2: 13,524,870 (GRCm39) Q195L probably benign Het
Ttc27 T A 17: 75,165,086 (GRCm39) V764D probably damaging Het
Ttc39d C A 17: 80,524,076 (GRCm39) S245* probably null Het
Ttc41 A G 10: 86,567,023 (GRCm39) E563G probably benign Het
Ttc41 A T 10: 86,569,571 (GRCm39) T650S probably benign Het
U2surp A C 9: 95,358,210 (GRCm39) L723R probably damaging Het
Ubqln3 G A 7: 103,791,524 (GRCm39) Q189* probably null Het
Vezf1 A G 11: 87,972,326 (GRCm39) N229S probably damaging Het
Vmn2r79 T A 7: 86,686,365 (GRCm39) M582K probably benign Het
Zfp518a A G 19: 40,902,567 (GRCm39) D832G probably benign Het
Zfyve28 T C 5: 34,356,216 (GRCm39) N762D probably damaging Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85,220,666 (GRCm39) start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85,259,623 (GRCm39) splice site probably null
IGL01380:Atxn10 APN 15 85,260,896 (GRCm39) nonsense probably null
IGL01408:Atxn10 APN 15 85,260,896 (GRCm39) nonsense probably null
3-1:Atxn10 UTSW 15 85,322,295 (GRCm39) splice site probably benign
R0190:Atxn10 UTSW 15 85,220,730 (GRCm39) missense possibly damaging 0.84
R0319:Atxn10 UTSW 15 85,249,483 (GRCm39) missense probably damaging 1.00
R1437:Atxn10 UTSW 15 85,243,675 (GRCm39) missense possibly damaging 0.47
R1746:Atxn10 UTSW 15 85,260,864 (GRCm39) missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85,249,513 (GRCm39) missense probably benign 0.37
R3055:Atxn10 UTSW 15 85,271,206 (GRCm39) missense probably benign 0.03
R4559:Atxn10 UTSW 15 85,322,321 (GRCm39) missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85,271,344 (GRCm39) missense probably benign 0.03
R4799:Atxn10 UTSW 15 85,260,909 (GRCm39) splice site probably null
R4831:Atxn10 UTSW 15 85,271,260 (GRCm39) missense probably benign 0.01
R5323:Atxn10 UTSW 15 85,275,944 (GRCm39) missense probably benign 0.00
R5335:Atxn10 UTSW 15 85,220,785 (GRCm39) splice site probably null
R5355:Atxn10 UTSW 15 85,346,515 (GRCm39) missense probably damaging 1.00
R5768:Atxn10 UTSW 15 85,277,621 (GRCm39) missense probably benign 0.01
R6277:Atxn10 UTSW 15 85,275,893 (GRCm39) missense probably benign 0.05
R6370:Atxn10 UTSW 15 85,277,586 (GRCm39) missense probably damaging 1.00
R6645:Atxn10 UTSW 15 85,260,904 (GRCm39) critical splice donor site probably null
R6957:Atxn10 UTSW 15 85,220,699 (GRCm39) missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85,346,526 (GRCm39) missense probably benign 0.01
R8031:Atxn10 UTSW 15 85,277,594 (GRCm39) missense probably benign
R9062:Atxn10 UTSW 15 85,275,918 (GRCm39) missense probably benign
R9171:Atxn10 UTSW 15 85,277,557 (GRCm39) missense probably damaging 1.00
R9201:Atxn10 UTSW 15 85,243,687 (GRCm39) missense probably damaging 0.98
R9429:Atxn10 UTSW 15 85,346,565 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTTACCTCTAACAGTCATGGG -3'
(R):5'- CAGCTCTGTCAGTAACCGTG -3'

Sequencing Primer
(F):5'- CCTCTAACAGTCATGGGAGTTAG -3'
(R):5'- CTCTGTCAGTAACCGTGTCAGAAG -3'
Posted On 2018-03-15