Mutagenetix > Incidental Mutations

Incidental Mutation 'R6261:Map3k19'

506671

Institutional Source

Beutler Lab

Gene Symbol

Map3k19

Ensembl Gene

ENSMUSG00000051590

Gene Name

mitogen-activated protein kinase kinase kinase 19

Synonyms

Ysk4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R6261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127815253-127855031 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127822599 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1005 (I1005T)

Ref Sequence

ENSEMBL: ENSMUSP00000146463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061512
AA Change: I801T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: I801T

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	232	248	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
S_TKc	1044	1307	3.18e-90	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187653
AA Change: I700T

SMART Domains

Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: I700T

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
low complexity region	121	137	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
S_TKc	933	1196	1.5e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189398

SMART Domains

Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	216	452	4.8e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191333

SMART Domains

Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590

Domain	Start	End	E-Value	Type
low complexity region	42	54	N/A	INTRINSIC
S_TKc	237	500	1.5e-92	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208183
AA Change: I1005T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	T	C	2: 164,795,059	D257G	probably damaging	Het
Adamtsl1	T	C	4: 86,336,878	V736A	probably benign	Het
Anln	A	G	9: 22,364,046	L521S	probably damaging	Het
Arfgap2	T	G	2: 91,270,282	S311A	probably benign	Het
Brdt	A	T	5: 107,348,503	E160D	probably benign	Het
Ccdc187	A	G	2: 26,276,203	I738T	probably damaging	Het
Cd59a	G	C	2: 104,104,205	G6A	probably damaging	Het
Cd5l	C	T	3: 87,368,608	P295L	probably benign	Het
Cnot1	A	G	8: 95,741,921	S1432P	probably benign	Het
Cnot8	T	A	11: 58,114,051	I192N	probably damaging	Het
Col4a1	G	T	8: 11,207,409		probably null	Het
Cuta	A	G	17: 26,939,327	L11P	possibly damaging	Het
Cyp2c39	G	A	19: 39,568,019	R433H	probably damaging	Het
Cyp4a12b	T	A	4: 115,414,543	Y150*	probably null	Het
Dcaf15	G	A	8: 84,099,105	A291V	probably benign	Het
Dcstamp	A	T	15: 39,754,735	H180L	possibly damaging	Het
Egfr	A	G	11: 16,889,964	I659M	probably benign	Het
Fzd8	A	G	18: 9,214,598	E560G	possibly damaging	Het
Gm28710	T	C	5: 16,812,185		noncoding transcript	Het
Gm5111	A	T	6: 48,589,592		probably benign	Het
Gm7945	T	C	14: 41,382,823	T214A	unknown	Het
Gpi1	T	C	7: 34,220,745	T168A	possibly damaging	Het
Gys2	T	C	6: 142,459,408	I218V	probably benign	Het
Gzmf	T	A	14: 56,206,492	I74L	probably benign	Het
Hacl1	G	A	14: 31,635,771	A70V	probably damaging	Het
Herc2	T	A	7: 56,197,072	L3590*	probably null	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Igfals	G	T	17: 24,881,365	V477F	possibly damaging	Het
Igkv8-28	A	T	6: 70,143,890	V23E	probably benign	Het
Isg20l2	T	A	3: 87,932,088	V202E	probably damaging	Het
Jakmip2	A	G	18: 43,575,534	I288T	probably benign	Het
Kansl3	A	G	1: 36,365,605	V88A	probably benign	Het
Kcna3	A	G	3: 107,037,950	T510A	possibly damaging	Het
Map2k5	G	T	9: 63,338,098	L140I	probably benign	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Ms4a14	T	A	19: 11,304,020	E391D	probably benign	Het
Mtrf1l	A	G	10: 5,815,550		probably null	Het
Myom1	A	G	17: 71,126,137	N1591S	probably damaging	Het
Nos1	G	A	5: 117,936,570	V1060M	probably benign	Het
Nsun5	C	T	5: 135,371,531	T142M	probably damaging	Het
Odc1	A	G	12: 17,550,654	E430G	probably benign	Het
Olfr957	C	A	9: 39,510,809	V304F	probably benign	Het
P2ry12	T	C	3: 59,217,907	I116V	probably null	Het
Patl1	T	A	19: 11,920,331	V94E	probably damaging	Het
Plin3	A	T	17: 56,281,488	Y255*	probably null	Het
Pou6f1	T	C	15: 100,579,946	T439A	probably damaging	Het
Prdm13	T	C	4: 21,678,366	K708R	probably damaging	Het
Prr14l	A	G	5: 32,829,404	S916P	possibly damaging	Het
Rab34	T	A	11: 78,191,202		probably null	Het
Rps7	A	G	12: 28,635,594	S21P	possibly damaging	Het
Scn9a	A	T	2: 66,483,896	L1815Q	probably damaging	Het
Sesn3	A	G	9: 14,321,163	Y244C	probably benign	Het
Slc15a2	A	G	16: 36,761,611	F284L	probably benign	Het
Slc25a44	C	T	3: 88,420,911	G72D	probably damaging	Het
Slco6d1	A	G	1: 98,499,863	T640A	probably benign	Het
Sspo	A	T	6: 48,462,191	E1591V	possibly damaging	Het
Tbata	C	A	10: 61,175,865	T60K	possibly damaging	Het
Tbc1d2	T	A	4: 46,637,692	T185S	possibly damaging	Het
Tmem56	T	A	3: 121,235,059	I60F	possibly damaging	Het
Tmem87a	A	G	2: 120,404,021	S14P	possibly damaging	Het
Tnnt2	C	A	1: 135,850,554		probably null	Het
Trex1	A	G	9: 109,058,641	V94A	probably benign	Het
Ubtfl1	A	C	9: 18,409,296	D40A	possibly damaging	Het
Zc3hav1	A	T	6: 38,333,000	Y296N	probably benign	Het
Zfp521	T	A	18: 13,844,627	N910Y	probably damaging	Het
Zfp53	A	G	17: 21,508,713	E336G	possibly damaging	Het

Other mutations in Map3k19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Map3k19	APN	1	127824331	nonsense	probably null
IGL01367:Map3k19	APN	1	127824351	missense	possibly damaging	0.88
IGL01443:Map3k19	APN	1	127838507	missense	probably benign	0.38
IGL01481:Map3k19	APN	1	127822478	missense	probably damaging	0.99
IGL01530:Map3k19	APN	1	127822104	missense	probably damaging	1.00
IGL01603:Map3k19	APN	1	127830273	missense	possibly damaging	0.89
IGL02044:Map3k19	APN	1	127823505	missense	probably damaging	1.00
IGL02159:Map3k19	APN	1	127823170	missense	probably benign	0.00
IGL02296:Map3k19	APN	1	127824246	missense	probably damaging	1.00
IGL02349:Map3k19	APN	1	127823769	missense	possibly damaging	0.48
IGL02823:Map3k19	APN	1	127822264	missense	probably benign	0.01
IGL02965:Map3k19	APN	1	127824066	missense	probably damaging	0.98
IGL03137:Map3k19	APN	1	127824315	missense	probably benign	0.04
R0125:Map3k19	UTSW	1	127823100	missense	probably benign	0.07
R0265:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0389:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0443:Map3k19	UTSW	1	127822415	missense	probably benign	0.08
R0465:Map3k19	UTSW	1	127838527	missense	probably damaging	1.00
R0645:Map3k19	UTSW	1	127822182	missense	possibly damaging	0.61
R0759:Map3k19	UTSW	1	127817425	missense	possibly damaging	0.90
R0815:Map3k19	UTSW	1	127834638	splice site	probably benign
R0838:Map3k19	UTSW	1	127823959	missense	probably benign	0.13
R1173:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1174:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1175:Map3k19	UTSW	1	127823880	missense	probably benign	0.17
R1457:Map3k19	UTSW	1	127817898	missense	probably damaging	1.00
R1661:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1665:Map3k19	UTSW	1	127817656	missense	possibly damaging	0.95
R1753:Map3k19	UTSW	1	127822680	missense	probably benign	0.02
R1944:Map3k19	UTSW	1	127823122	missense	probably benign	0.29
R2496:Map3k19	UTSW	1	127823086	missense	probably damaging	1.00
R2878:Map3k19	UTSW	1	127823793	missense	possibly damaging	0.61
R2895:Map3k19	UTSW	1	127822098	missense	possibly damaging	0.60
R3025:Map3k19	UTSW	1	127838553	critical splice acceptor site	probably null
R4577:Map3k19	UTSW	1	127822813	nonsense	probably null
R4612:Map3k19	UTSW	1	127815300	missense	probably benign	0.07
R4888:Map3k19	UTSW	1	127817733	missense	probably damaging	1.00
R4927:Map3k19	UTSW	1	127822195	missense	probably benign	0.08
R5028:Map3k19	UTSW	1	127823232	missense	probably benign	0.00
R5050:Map3k19	UTSW	1	127823562	missense	probably benign	0.21
R5131:Map3k19	UTSW	1	127823690	missense	possibly damaging	0.78
R5556:Map3k19	UTSW	1	127834547	nonsense	probably null
R5606:Map3k19	UTSW	1	127822957	missense	probably benign
R5617:Map3k19	UTSW	1	127822966	missense	probably damaging	1.00
R5755:Map3k19	UTSW	1	127822381	missense	probably benign	0.02
R5854:Map3k19	UTSW	1	127830355	missense	probably damaging	0.96
R5952:Map3k19	UTSW	1	127822740	missense	probably benign	0.01
R6132:Map3k19	UTSW	1	127850476	missense	possibly damaging	0.53
R6175:Map3k19	UTSW	1	127822832	missense	probably benign	0.05
R6471:Map3k19	UTSW	1	127817254	missense	probably damaging	1.00
R6726:Map3k19	UTSW	1	127820448	missense	probably benign	0.09
R6732:Map3k19	UTSW	1	127824232	missense	probably benign	0.37
R6762:Map3k19	UTSW	1	127847264	missense	probably damaging	1.00
R7366:Map3k19	UTSW	1	127817455	missense	probably damaging	1.00
R7414:Map3k19	UTSW	1	127838452	missense	probably damaging	0.99
R7686:Map3k19	UTSW	1	127822248	nonsense	probably null
R7702:Map3k19	UTSW	1	127829090	missense	probably damaging	1.00
R7849:Map3k19	UTSW	1	127823646	missense	probably benign	0.21
R8129:Map3k19	UTSW	1	127822683	missense	possibly damaging	0.90
R8134:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8136:Map3k19	UTSW	1	127823755	missense	probably damaging	0.99
R8264:Map3k19	UTSW	1	127823791	missense
R8305:Map3k19	UTSW	1	127817270	missense
R8511:Map3k19	UTSW	1	127847418	missense	possibly damaging	0.71
Z1177:Map3k19	UTSW	1	127822034	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GTGCTTTTCTGGAGACACACG -3'
(R):5'- AGCACAGAGGGTTCATTTCTAAAG -3'

Sequencing Primer
(F):5'- TTCTGGAGACACACGCTTGC -3'
(R):5'- GGTTCATTTCTAAAGACAAAGGTTGC -3'

Posted On

2018-03-15