Mutagenetix > Incidental Mutations

Incidental Mutation 'R6261:Scn9a'

506674

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66483896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1815 (L1815Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably damaging
Transcript: ENSMUST00000100063
AA Change: L1817Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: L1817Q

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100064
AA Change: L1826Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: L1826Q

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112354
AA Change: L1815Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: L1815Q

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152740

Predicted Effect

probably damaging
Transcript: ENSMUST00000164384
AA Change: L1826Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: L1826Q

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: L1815Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: L1815Q

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	T	C	2: 164,795,059	D257G	probably damaging	Het
Adamtsl1	T	C	4: 86,336,878	V736A	probably benign	Het
Anln	A	G	9: 22,364,046	L521S	probably damaging	Het
Arfgap2	T	G	2: 91,270,282	S311A	probably benign	Het
Brdt	A	T	5: 107,348,503	E160D	probably benign	Het
Ccdc187	A	G	2: 26,276,203	I738T	probably damaging	Het
Cd59a	G	C	2: 104,104,205	G6A	probably damaging	Het
Cd5l	C	T	3: 87,368,608	P295L	probably benign	Het
Cnot1	A	G	8: 95,741,921	S1432P	probably benign	Het
Cnot8	T	A	11: 58,114,051	I192N	probably damaging	Het
Col4a1	G	T	8: 11,207,409		probably null	Het
Cuta	A	G	17: 26,939,327	L11P	possibly damaging	Het
Cyp2c39	G	A	19: 39,568,019	R433H	probably damaging	Het
Cyp4a12b	T	A	4: 115,414,543	Y150*	probably null	Het
Dcaf15	G	A	8: 84,099,105	A291V	probably benign	Het
Dcstamp	A	T	15: 39,754,735	H180L	possibly damaging	Het
Egfr	A	G	11: 16,889,964	I659M	probably benign	Het
Fzd8	A	G	18: 9,214,598	E560G	possibly damaging	Het
Gm28710	T	C	5: 16,812,185		noncoding transcript	Het
Gm5111	A	T	6: 48,589,592		probably benign	Het
Gm7945	T	C	14: 41,382,823	T214A	unknown	Het
Gpi1	T	C	7: 34,220,745	T168A	possibly damaging	Het
Gys2	T	C	6: 142,459,408	I218V	probably benign	Het
Gzmf	T	A	14: 56,206,492	I74L	probably benign	Het
Hacl1	G	A	14: 31,635,771	A70V	probably damaging	Het
Herc2	T	A	7: 56,197,072	L3590*	probably null	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Igfals	G	T	17: 24,881,365	V477F	possibly damaging	Het
Igkv8-28	A	T	6: 70,143,890	V23E	probably benign	Het
Isg20l2	T	A	3: 87,932,088	V202E	probably damaging	Het
Jakmip2	A	G	18: 43,575,534	I288T	probably benign	Het
Kansl3	A	G	1: 36,365,605	V88A	probably benign	Het
Kcna3	A	G	3: 107,037,950	T510A	possibly damaging	Het
Map2k5	G	T	9: 63,338,098	L140I	probably benign	Het
Map3k19	A	G	1: 127,822,599	I1005T	possibly damaging	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Ms4a14	T	A	19: 11,304,020	E391D	probably benign	Het
Mtrf1l	A	G	10: 5,815,550		probably null	Het
Myom1	A	G	17: 71,126,137	N1591S	probably damaging	Het
Nos1	G	A	5: 117,936,570	V1060M	probably benign	Het
Nsun5	C	T	5: 135,371,531	T142M	probably damaging	Het
Odc1	A	G	12: 17,550,654	E430G	probably benign	Het
Olfr957	C	A	9: 39,510,809	V304F	probably benign	Het
P2ry12	T	C	3: 59,217,907	I116V	probably null	Het
Patl1	T	A	19: 11,920,331	V94E	probably damaging	Het
Plin3	A	T	17: 56,281,488	Y255*	probably null	Het
Pou6f1	T	C	15: 100,579,946	T439A	probably damaging	Het
Prdm13	T	C	4: 21,678,366	K708R	probably damaging	Het
Prr14l	A	G	5: 32,829,404	S916P	possibly damaging	Het
Rab34	T	A	11: 78,191,202		probably null	Het
Rps7	A	G	12: 28,635,594	S21P	possibly damaging	Het
Sesn3	A	G	9: 14,321,163	Y244C	probably benign	Het
Slc15a2	A	G	16: 36,761,611	F284L	probably benign	Het
Slc25a44	C	T	3: 88,420,911	G72D	probably damaging	Het
Slco6d1	A	G	1: 98,499,863	T640A	probably benign	Het
Sspo	A	T	6: 48,462,191	E1591V	possibly damaging	Het
Tbata	C	A	10: 61,175,865	T60K	possibly damaging	Het
Tbc1d2	T	A	4: 46,637,692	T185S	possibly damaging	Het
Tmem56	T	A	3: 121,235,059	I60F	possibly damaging	Het
Tmem87a	A	G	2: 120,404,021	S14P	possibly damaging	Het
Tnnt2	C	A	1: 135,850,554		probably null	Het
Trex1	A	G	9: 109,058,641	V94A	probably benign	Het
Ubtfl1	A	C	9: 18,409,296	D40A	possibly damaging	Het
Zc3hav1	A	T	6: 38,333,000	Y296N	probably benign	Het
Zfp521	T	A	18: 13,844,627	N910Y	probably damaging	Het
Zfp53	A	G	17: 21,508,713	E336G	possibly damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TAGTCGCAGATACATCCTCTTG -3'
(R):5'- GAACTTCAGCGTTGCCACAG -3'

Sequencing Primer
(F):5'- GCAGATACATCCTCTTGTTTTCG -3'
(R):5'- CTTCAGCGTTGCCACAGAAGAAAG -3'

Posted On

2018-03-15