Incidental Mutation 'R6261:Arfgap2'
ID506675
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R6261 (G1)
Quality Score202.009
Status Validated
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91270282 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 311 (S311A)
Ref Sequence ENSEMBL: ENSMUSP00000078920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000064652] [ENSMUST00000080008]
Predicted Effect probably benign
Transcript: ENSMUST00000028691
AA Change: S325A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255
AA Change: S325A

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064652
Predicted Effect probably benign
Transcript: ENSMUST00000080008
AA Change: S311A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255
AA Change: S311A

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150753
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0178:Arfgap2 UTSW 2 91267361 missense probably benign 0.00
R0927:Arfgap2 UTSW 2 91273805 missense probably benign 0.05
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5249:Arfgap2 UTSW 2 91265637 nonsense probably null
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
R7531:Arfgap2 UTSW 2 91273744 splice site probably null
R8058:Arfgap2 UTSW 2 91266299 critical splice donor site unknown
Z1177:Arfgap2 UTSW 2 91275104 missense not run
Predicted Primers PCR Primer
(F):5'- CAGAAGAGTCCATGTGCGTG -3'
(R):5'- ACTAACACGTGTGGCCAACC -3'

Sequencing Primer
(F):5'- AGTCCATGTGCGTGATGGC -3'
(R):5'- TGGCCAACCACTGTCCAAGG -3'
Posted On2018-03-15