Incidental Mutation 'R6261:Tmem87a'
ID506677
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Nametransmembrane protein 87A
SynonymsA930025J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120355312-120404113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120404021 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 14 (S14P)
Ref Sequence ENSEMBL: ENSMUSP00000087500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729] [ENSMUST00000135074]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043755
Predicted Effect probably benign
Transcript: ENSMUST00000090042
AA Change: S14P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808
AA Change: S14P

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090046
AA Change: S14P

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808
AA Change: S14P

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110729
AA Change: S14P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808
AA Change: S14P

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131523
Predicted Effect probably benign
Transcript: ENSMUST00000135074
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151740
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
ANU18:Tmem87a UTSW 2 120380769 missense probably benign 0.01
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2396:Tmem87a UTSW 2 120404059 start codon destroyed probably null 0.02
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5642:Tmem87a UTSW 2 120403946 missense probably benign 0.00
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6158:Tmem87a UTSW 2 120360103 splice site probably null
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8124:Tmem87a UTSW 2 120392195 missense probably benign
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATCTTCCTGGACCCCTTGG -3'
(R):5'- GTAGACTCAAAGTTTCTGGGGCG -3'

Sequencing Primer
(F):5'- CCTTGGGCCACCGTAGC -3'
(R):5'- CTCTGAGCGTCTGTGGGAAGAAG -3'
Posted On2018-03-15