Incidental Mutation 'R6261:Cd5l'
ID506680
Institutional Source Beutler Lab
Gene Symbol Cd5l
Ensembl Gene ENSMUSG00000015854
Gene NameCD5 antigen-like
SynonymsSp-alpha, Pdp 1/6, AAC-11, AIM/Spalpha, Api6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87357881-87371073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87368608 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 295 (P295L)
Ref Sequence ENSEMBL: ENSMUSP00000015998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015998]
Predicted Effect probably benign
Transcript: ENSMUST00000015998
AA Change: P295L

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000015998
Gene: ENSMUSG00000015854
AA Change: P295L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SR 27 128 3.42e-41 SMART
SR 141 241 3.56e-39 SMART
SR 246 348 2.78e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit enhanced and prolonged bacterial-induced granuloma formation and increased apoptosis of NKT and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Cd5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Cd5l APN 3 87367811 missense probably benign 0.01
IGL02301:Cd5l APN 3 87365993 missense probably benign 0.02
IGL02639:Cd5l APN 3 87368506 missense probably damaging 1.00
R1104:Cd5l UTSW 3 87360899 missense probably benign 0.06
R1763:Cd5l UTSW 3 87367880 critical splice donor site probably null
R1775:Cd5l UTSW 3 87368659 missense probably damaging 1.00
R4614:Cd5l UTSW 3 87368619 missense probably benign
R4618:Cd5l UTSW 3 87368619 missense probably benign
R4838:Cd5l UTSW 3 87365951 missense probably benign 0.41
R4871:Cd5l UTSW 3 87367622 missense probably damaging 1.00
R4980:Cd5l UTSW 3 87367601 missense probably benign 0.33
R5611:Cd5l UTSW 3 87367775 missense possibly damaging 0.64
R5632:Cd5l UTSW 3 87366107 nonsense probably null
R7017:Cd5l UTSW 3 87366061 nonsense probably null
R7727:Cd5l UTSW 3 87367855 nonsense probably null
X0025:Cd5l UTSW 3 87368761 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCTGCAGATCCTTTTGAGC -3'
(R):5'- ATTCCCATGACCCACAGTG -3'

Sequencing Primer
(F):5'- GCTGAAGCTGGTGGGAG -3'
(R):5'- CCCTTTGAAGTGCGACTTTAGCAG -3'
Posted On2018-03-15