Incidental Mutation 'R6261:Kcna3'
ID506683
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107037950 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 510 (T510A)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052718
AA Change: T510A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: T510A

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070085
SMART Domains Protein: ENSMUSP00000066165
Gene: ENSMUSG00000056145

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Meta Mutation Damage Score 0.0566 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL02802:Kcna3 UTSW 3 107037053 missense probably damaging 0.99
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1922:Kcna3 UTSW 3 107037935 missense possibly damaging 0.47
R1950:Kcna3 UTSW 3 107037672 missense probably damaging 1.00
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6423:Kcna3 UTSW 3 107036842 nonsense probably null
R6850:Kcna3 UTSW 3 107037159 missense probably damaging 1.00
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
R7524:Kcna3 UTSW 3 107037207 missense probably damaging 1.00
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Z1176:Kcna3 UTSW 3 107037266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCAGTACATGCACGTG -3'
(R):5'- CCTGTTTCAGTATGAAGCAATAGGG -3'

Sequencing Primer
(F):5'- ACATGCACGTGGGCAGTTG -3'
(R):5'- AAGTGTGCTTCCTCACTTCTTGTAC -3'
Posted On2018-03-15