Mutagenetix > Incidental Mutations

Incidental Mutation 'R6261:Map2k5'

506708

Institutional Source

Beutler Lab

Gene Symbol

Map2k5

Ensembl Gene

ENSMUSG00000058444

Gene Name

mitogen-activated protein kinase kinase 5

Synonyms

MEK5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63163768-63377902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 63338098 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 140 (L140I)

Ref Sequence

ENSEMBL: ENSMUSP00000034920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034920]

PDB Structure

Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000034920
AA Change: L140I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: L140I

Domain	Start	End	E-Value	Type
PB1	18	97	7.59e-12	SMART
S_TKc	166	419	7.75e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216999

Meta Mutation Damage Score

0.0684

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	T	C	2: 164,795,059	D257G	probably damaging	Het
Adamtsl1	T	C	4: 86,336,878	V736A	probably benign	Het
Anln	A	G	9: 22,364,046	L521S	probably damaging	Het
Arfgap2	T	G	2: 91,270,282	S311A	probably benign	Het
Brdt	A	T	5: 107,348,503	E160D	probably benign	Het
Ccdc187	A	G	2: 26,276,203	I738T	probably damaging	Het
Cd59a	G	C	2: 104,104,205	G6A	probably damaging	Het
Cd5l	C	T	3: 87,368,608	P295L	probably benign	Het
Cnot1	A	G	8: 95,741,921	S1432P	probably benign	Het
Cnot8	T	A	11: 58,114,051	I192N	probably damaging	Het
Col4a1	G	T	8: 11,207,409		probably null	Het
Cuta	A	G	17: 26,939,327	L11P	possibly damaging	Het
Cyp2c39	G	A	19: 39,568,019	R433H	probably damaging	Het
Cyp4a12b	T	A	4: 115,414,543	Y150*	probably null	Het
Dcaf15	G	A	8: 84,099,105	A291V	probably benign	Het
Dcstamp	A	T	15: 39,754,735	H180L	possibly damaging	Het
Egfr	A	G	11: 16,889,964	I659M	probably benign	Het
Fzd8	A	G	18: 9,214,598	E560G	possibly damaging	Het
Gm28710	T	C	5: 16,812,185		noncoding transcript	Het
Gm5111	A	T	6: 48,589,592		probably benign	Het
Gm7945	T	C	14: 41,382,823	T214A	unknown	Het
Gpi1	T	C	7: 34,220,745	T168A	possibly damaging	Het
Gys2	T	C	6: 142,459,408	I218V	probably benign	Het
Gzmf	T	A	14: 56,206,492	I74L	probably benign	Het
Hacl1	G	A	14: 31,635,771	A70V	probably damaging	Het
Herc2	T	A	7: 56,197,072	L3590*	probably null	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Igfals	G	T	17: 24,881,365	V477F	possibly damaging	Het
Igkv8-28	A	T	6: 70,143,890	V23E	probably benign	Het
Isg20l2	T	A	3: 87,932,088	V202E	probably damaging	Het
Jakmip2	A	G	18: 43,575,534	I288T	probably benign	Het
Kansl3	A	G	1: 36,365,605	V88A	probably benign	Het
Kcna3	A	G	3: 107,037,950	T510A	possibly damaging	Het
Map3k19	A	G	1: 127,822,599	I1005T	possibly damaging	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Ms4a14	T	A	19: 11,304,020	E391D	probably benign	Het
Mtrf1l	A	G	10: 5,815,550		probably null	Het
Myom1	A	G	17: 71,126,137	N1591S	probably damaging	Het
Nos1	G	A	5: 117,936,570	V1060M	probably benign	Het
Nsun5	C	T	5: 135,371,531	T142M	probably damaging	Het
Odc1	A	G	12: 17,550,654	E430G	probably benign	Het
Olfr957	C	A	9: 39,510,809	V304F	probably benign	Het
P2ry12	T	C	3: 59,217,907	I116V	probably null	Het
Patl1	T	A	19: 11,920,331	V94E	probably damaging	Het
Plin3	A	T	17: 56,281,488	Y255*	probably null	Het
Pou6f1	T	C	15: 100,579,946	T439A	probably damaging	Het
Prdm13	T	C	4: 21,678,366	K708R	probably damaging	Het
Prr14l	A	G	5: 32,829,404	S916P	possibly damaging	Het
Rab34	T	A	11: 78,191,202		probably null	Het
Rps7	A	G	12: 28,635,594	S21P	possibly damaging	Het
Scn9a	A	T	2: 66,483,896	L1815Q	probably damaging	Het
Sesn3	A	G	9: 14,321,163	Y244C	probably benign	Het
Slc15a2	A	G	16: 36,761,611	F284L	probably benign	Het
Slc25a44	C	T	3: 88,420,911	G72D	probably damaging	Het
Slco6d1	A	G	1: 98,499,863	T640A	probably benign	Het
Sspo	A	T	6: 48,462,191	E1591V	possibly damaging	Het
Tbata	C	A	10: 61,175,865	T60K	possibly damaging	Het
Tbc1d2	T	A	4: 46,637,692	T185S	possibly damaging	Het
Tmem56	T	A	3: 121,235,059	I60F	possibly damaging	Het
Tmem87a	A	G	2: 120,404,021	S14P	possibly damaging	Het
Tnnt2	C	A	1: 135,850,554		probably null	Het
Trex1	A	G	9: 109,058,641	V94A	probably benign	Het
Ubtfl1	A	C	9: 18,409,296	D40A	possibly damaging	Het
Zc3hav1	A	T	6: 38,333,000	Y296N	probably benign	Het
Zfp521	T	A	18: 13,844,627	N910Y	probably damaging	Het
Zfp53	A	G	17: 21,508,713	E336G	possibly damaging	Het

Other mutations in Map2k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Map2k5	APN	9	63281077	splice site	probably benign
IGL01412:Map2k5	APN	9	63293706	missense	probably damaging	1.00
IGL01766:Map2k5	APN	9	63377227	missense	probably benign
IGL02246:Map2k5	APN	9	63377129	missense	probably benign	0.10
IGL02270:Map2k5	APN	9	63322197	splice site	probably null
IGL02793:Map2k5	APN	9	63257039	missense	probably benign	0.32
IGL03236:Map2k5	APN	9	63286392	splice site	probably benign
R0007:Map2k5	UTSW	9	63293724	missense	probably damaging	1.00
R0217:Map2k5	UTSW	9	63256975	critical splice donor site	probably null
R0315:Map2k5	UTSW	9	63303151	missense	probably damaging	1.00
R0801:Map2k5	UTSW	9	63357979	splice site	probably benign
R1122:Map2k5	UTSW	9	63263163	missense	probably damaging	1.00
R1822:Map2k5	UTSW	9	63235303	missense	possibly damaging	0.79
R4308:Map2k5	UTSW	9	63235304	missense	probably benign	0.02
R4421:Map2k5	UTSW	9	63164130	missense	probably damaging	0.96
R4720:Map2k5	UTSW	9	63293719	missense	probably damaging	1.00
R4869:Map2k5	UTSW	9	63322243	nonsense	probably null
R5059:Map2k5	UTSW	9	63257014	missense	probably benign	0.41
R5138:Map2k5	UTSW	9	63263158	missense	probably damaging	0.99
R6005:Map2k5	UTSW	9	63281019	missense	probably damaging	1.00
R6258:Map2k5	UTSW	9	63217365	missense	probably benign	0.16
R6498:Map2k5	UTSW	9	63286401	missense	possibly damaging	0.74
R6808:Map2k5	UTSW	9	63322246	missense	probably benign	0.00
R7228:Map2k5	UTSW	9	63358022	missense	probably damaging	1.00
R7819:Map2k5	UTSW	9	63358018	missense	probably damaging	0.99
R8053:Map2k5	UTSW	9	63343425	missense	probably benign	0.16
Z1176:Map2k5	UTSW	9	63358038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCAGTCAATATGTAGCAAGAGC -3'
(R):5'- TCCAGATTGTACACTTCTGTAGCATG -3'

Sequencing Primer
(F):5'- GACAAGTGTGTTGCACCA -3'
(R):5'- CTGAATATACTCCAGCAGTGGGTC -3'

Posted On

2018-03-15