Incidental Mutation 'R6261:Egfr'
ID506712
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16889964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 659 (I659M)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: I659M

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: I659M

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGACTTAGCCACCAGTC -3'
(R):5'- TCTAATGTATGAAATCCCACGCTAC -3'

Sequencing Primer
(F):5'- GGGACTTAGCCACCAGTCATTTC -3'
(R):5'- TGTATGAAATCCCACGCTACAAATTC -3'
Posted On2018-03-15