Incidental Mutation 'R6261:Pou6f1'
ID506720
Institutional Source Beutler Lab
Gene Symbol Pou6f1
Ensembl Gene ENSMUSG00000009739
Gene NamePOU domain, class 6, transcription factor 1
Synonymscns-1, Emb, 2310038G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location100575318-100599984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100579946 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 439 (T439A)
Ref Sequence ENSEMBL: ENSMUSP00000073504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058274] [ENSMUST00000073837] [ENSMUST00000176271] [ENSMUST00000176300] [ENSMUST00000177202]
Predicted Effect probably benign
Transcript: ENSMUST00000058274
SMART Domains Protein: ENSMUSP00000049955
Gene: ENSMUSG00000009739

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073837
AA Change: T439A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073504
Gene: ENSMUSG00000009739
AA Change: T439A

DomainStartEndE-ValueType
low complexity region 174 232 N/A INTRINSIC
POU 414 488 6.32e-44 SMART
HOX 509 571 7.03e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176140
SMART Domains Protein: ENSMUSP00000135670
Gene: ENSMUSG00000009739

DomainStartEndE-ValueType
POU 139 213 6.32e-44 SMART
HOX 234 296 7.03e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176271
AA Change: T164A

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134760
Gene: ENSMUSG00000009739
AA Change: T164A

DomainStartEndE-ValueType
POU 139 213 6.32e-44 SMART
HOX 234 296 7.03e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176271
AA Change: T164A

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000176300
Predicted Effect probably benign
Transcript: ENSMUST00000177202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177335
SMART Domains Protein: ENSMUSP00000135627
Gene: ENSMUSG00000009739

DomainStartEndE-ValueType
POU 28 102 6.32e-44 SMART
HOX 123 185 7.03e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230790
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Cyp4a12b T A 4: 115,414,543 Y150* probably null Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Pou6f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pou6f1 APN 15 100580047 splice site probably benign
IGL02451:Pou6f1 APN 15 100579940 missense possibly damaging 0.80
IGL02545:Pou6f1 APN 15 100583425 nonsense probably null
R0076:Pou6f1 UTSW 15 100587836 nonsense probably null
R0076:Pou6f1 UTSW 15 100587836 nonsense probably null
R0212:Pou6f1 UTSW 15 100580815 missense possibly damaging 0.75
R1297:Pou6f1 UTSW 15 100578305 missense probably damaging 1.00
R2863:Pou6f1 UTSW 15 100580808 unclassified probably null
R2905:Pou6f1 UTSW 15 100585958 missense probably benign
R3418:Pou6f1 UTSW 15 100580924 missense probably benign 0.00
R4161:Pou6f1 UTSW 15 100580843 missense probably damaging 0.98
R4793:Pou6f1 UTSW 15 100578412 missense probably damaging 1.00
R5617:Pou6f1 UTSW 15 100585993 missense possibly damaging 0.95
R5947:Pou6f1 UTSW 15 100586120 missense possibly damaging 0.77
R6731:Pou6f1 UTSW 15 100579883 missense possibly damaging 0.57
R7696:Pou6f1 UTSW 15 100584098 missense probably benign 0.30
X0019:Pou6f1 UTSW 15 100583322 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACAGTCTTCCTTATGCGG -3'
(R):5'- AGCTCCCTTTGATGTGCCAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- AGCACACCCTCATCTTCATG -3'
Posted On2018-03-15