Incidental Mutation 'R6262:Stat4'
ID506734
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Namesignal transducer and activator of transcription 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location51987148-52107189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52102201 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 569 (W569R)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
Predicted Effect probably null
Transcript: ENSMUST00000027277
AA Change: W569R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: W569R

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168302
AA Change: W569R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: W569R

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187554
Meta Mutation Damage Score 0.9720 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3683:Stat4 UTSW 1 52013822 missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52096867 missense probably damaging 0.96
R6161:Stat4 UTSW 1 52074677 missense possibly damaging 0.94
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6767:Stat4 UTSW 1 52076583 missense probably benign 0.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
R7507:Stat4 UTSW 1 52078574 missense probably damaging 1.00
R7539:Stat4 UTSW 1 52071709 intron probably null
R7546:Stat4 UTSW 1 52098463 missense probably damaging 0.98
R7616:Stat4 UTSW 1 52013878 nonsense probably null
R7751:Stat4 UTSW 1 52082552 missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52079773 missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52084099 nonsense probably null
Z1177:Stat4 UTSW 1 52098485 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCTGCCCTGCTCAAAG -3'
(R):5'- AATTCATCATTATCGCATCCGC -3'

Sequencing Primer
(F):5'- CCTGCTCAAAGGGAACATTTG -3'
(R):5'- AGCAACTGTACCTGGAATCTC -3'
Posted On2018-03-15