Incidental Mutation 'R6262:Cdk5rap1'
ID506739
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154370686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000105352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109730] [ENSMUST00000109731]
Predicted Effect probably benign
Transcript: ENSMUST00000028990
AA Change: D84G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: D84G

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109730
AA Change: D84G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105352
Gene: ENSMUSG00000027487
AA Change: D84G

DomainStartEndE-ValueType
Pfam:UPF0004 100 181 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109731
AA Change: D84G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: D84G

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150308
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154360654 missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154368895 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154345868 frame shift probably null
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154360732 missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154360675 missense probably damaging 1.00
R7650:Cdk5rap1 UTSW 2 154354116 missense probably benign 0.01
R8424:Cdk5rap1 UTSW 2 154346012 missense probably damaging 1.00
R8694:Cdk5rap1 UTSW 2 154353228 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAGTAATGCTACTTCGTGGGC -3'
(R):5'- GCACCATTCACCTCCATGTG -3'

Sequencing Primer
(F):5'- GGTTTTATATTAATCAACCTGCCCAC -3'
(R):5'- TTGCTTAGGACCTGCAGAGCAC -3'
Posted On2018-03-15