Incidental Mutation 'R6262:Zfp326'
ID506750
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Namezinc finger protein 326
Synonyms5730470H14Rik, ZAN75
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105876565-105915818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105888487 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 88 (L88Q)
Ref Sequence ENSEMBL: ENSMUSP00000031227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440]
Predicted Effect probably damaging
Transcript: ENSMUST00000031227
AA Change: L88Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290
AA Change: L88Q

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150109
Predicted Effect probably benign
Transcript: ENSMUST00000150440
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 105907045 missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 105896533 missense probably damaging 0.98
IGL01551:Zfp326 APN 5 105888585 missense probably damaging 1.00
IGL03197:Zfp326 APN 5 105891193 missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 105914690 missense probably benign 0.02
R0326:Zfp326 UTSW 5 105910275 missense probably damaging 1.00
R0411:Zfp326 UTSW 5 105878775 missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 105886203 nonsense probably null
R0850:Zfp326 UTSW 5 105878797 splice site probably null
R1833:Zfp326 UTSW 5 105891169 nonsense probably null
R2108:Zfp326 UTSW 5 105914780 utr 3 prime probably benign
R2857:Zfp326 UTSW 5 105888529 missense probably benign 0.11
R3702:Zfp326 UTSW 5 105888843 splice site probably null
R4690:Zfp326 UTSW 5 105907076 missense probably damaging 1.00
R5614:Zfp326 UTSW 5 105888495 missense probably damaging 1.00
R6212:Zfp326 UTSW 5 105910231 missense probably damaging 1.00
R6274:Zfp326 UTSW 5 105905980 missense probably damaging 1.00
R6439:Zfp326 UTSW 5 105888718 missense probably null 0.69
R6963:Zfp326 UTSW 5 105911493 nonsense probably null
R8073:Zfp326 UTSW 5 105914816 missense unknown
Z1088:Zfp326 UTSW 5 105888630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTTGAACTGCCCAGCC -3'
(R):5'- CATAAACCCAGGCCTCAATTTTG -3'

Sequencing Primer
(F):5'- TGCCCAGCCCTAATCAAGTGTG -3'
(R):5'- CAGGCCTCAATTTTGAACGG -3'
Posted On2018-03-15