Incidental Mutation 'R6262:Slc6a6'
ID506753
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91755032 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 614 (H614L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032185
AA Change: H614L

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: H614L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206988
Meta Mutation Damage Score 0.2447 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
customary UTSW 6 91726243 nonsense probably null
durango UTSW 6 91723471 missense probably damaging 1.00
habit UTSW 6 91740971 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91724851 missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91739965 missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91741245 missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91726106 missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91740971 missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91724970 missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91726243 nonsense probably null
R8363:Slc6a6 UTSW 6 91750296 missense probably benign 0.03
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCCTGGGATGTTCTAGAG -3'
(R):5'- ACGTAGGCCTATGGGTTTTC -3'

Sequencing Primer
(F):5'- CCTGGGATGTTCTAGAGGTGGG -3'
(R):5'- CTCTGTAAACCTGGTCCTAT -3'
Posted On2018-03-15