Incidental Mutation 'R6262:Trim30a'
ID506761
Institutional Source Beutler Lab
Gene Symbol Trim30a
Ensembl Gene ENSMUSG00000030921
Gene Nametripartite motif-containing 30A
SynonymsRpt-1, Rpt1, Trim30
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104409025-104465193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104411534 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 345 (L345P)
Ref Sequence ENSEMBL: ENSMUSP00000076189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076922]
PDB Structure
Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000076922
AA Change: L345P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: L345P

DomainStartEndE-ValueType
RING 15 58 2.88e-10 SMART
BBOX 91 132 3.52e-14 SMART
coiled coil region 173 241 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
Pfam:SPRY 349 493 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142124
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Trim30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Trim30a APN 7 104435913 missense probably damaging 1.00
IGL02944:Trim30a APN 7 104435777 missense probably benign 0.19
IGL03135:Trim30a APN 7 104411141 missense probably damaging 0.98
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0682:Trim30a UTSW 7 104429182 missense probably damaging 1.00
R1773:Trim30a UTSW 7 104435901 missense probably damaging 1.00
R1862:Trim30a UTSW 7 104411198 missense probably damaging 0.99
R1872:Trim30a UTSW 7 104429210 missense probably benign 0.01
R1986:Trim30a UTSW 7 104411465 missense probably damaging 1.00
R1991:Trim30a UTSW 7 104430230 splice site probably benign
R2259:Trim30a UTSW 7 104411504 missense probably damaging 1.00
R2571:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R3719:Trim30a UTSW 7 104411163 missense probably benign 0.00
R3880:Trim30a UTSW 7 104411189 missense probably benign
R3910:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3911:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3912:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R4343:Trim30a UTSW 7 104435592 missense probably benign 0.00
R4572:Trim30a UTSW 7 104411188 nonsense probably null
R4587:Trim30a UTSW 7 104435644 nonsense probably null
R4997:Trim30a UTSW 7 104411620 missense probably benign 0.21
R5051:Trim30a UTSW 7 104411706 intron probably benign
R5414:Trim30a UTSW 7 104411141 missense probably damaging 1.00
R5613:Trim30a UTSW 7 104430182 missense probably damaging 1.00
R5930:Trim30a UTSW 7 104421450 missense possibly damaging 0.95
R7133:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R7222:Trim30a UTSW 7 104421432 splice site probably null
R7739:Trim30a UTSW 7 104430179 missense possibly damaging 0.50
R7797:Trim30a UTSW 7 104411200 missense possibly damaging 0.86
R7803:Trim30a UTSW 7 104411397 nonsense probably null
R7836:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7908:Trim30a UTSW 7 104421449 missense probably benign 0.01
R7919:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7989:Trim30a UTSW 7 104421449 missense probably benign 0.01
X0012:Trim30a UTSW 7 104430203 nonsense probably null
Z1088:Trim30a UTSW 7 104435654 missense probably damaging 1.00
Z1177:Trim30a UTSW 7 104411463 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTAGCCACATTTAGGC -3'
(R):5'- ACAAGGCTTCTCCAAGTTTCCTTG -3'

Sequencing Primer
(F):5'- GTAGCCACATTTAGGCTGAAAC -3'
(R):5'- GCTTAAGTTACAAATAAGGTTGCACC -3'
Posted On2018-03-15