Incidental Mutation 'R6262:Grin3b'
ID506770
Institutional Source Beutler Lab
Gene Symbol Grin3b
Ensembl Gene ENSMUSG00000035745
Gene Nameglutamate receptor, ionotropic, NMDA3B
SynonymsNR3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79970715-79977190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79974369 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 570 (M570L)
Ref Sequence ENSEMBL: ENSMUSP00000048576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000045247] [ENSMUST00000052885]
Predicted Effect probably benign
Transcript: ENSMUST00000045085
AA Change: M570L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745
AA Change: M570L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045247
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052885
SMART Domains Protein: ENSMUSP00000056792
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 34 131 3.3e-44 PFAM
Pfam:Membralin 138 393 3.9e-130 PFAM
transmembrane domain 394 411 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 483 521 N/A INTRINSIC
low complexity region 531 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124536
SMART Domains Protein: ENSMUSP00000119572
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 4 101 1.6e-44 PFAM
Pfam:Membralin 108 297 7.7e-83 PFAM
Pfam:Membralin 316 387 5e-42 PFAM
transmembrane domain 388 405 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 477 515 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126383
Predicted Effect probably benign
Transcript: ENSMUST00000131816
SMART Domains Protein: ENSMUSP00000122984
Gene: ENSMUSG00000035745

DomainStartEndE-ValueType
Pfam:Lig_chan 1 368 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132080
Predicted Effect unknown
Transcript: ENSMUST00000149148
AA Change: M211L
SMART Domains Protein: ENSMUSP00000116887
Gene: ENSMUSG00000035745
AA Change: M211L

DomainStartEndE-ValueType
PBPe 100 452 1.01e-82 SMART
Lig_chan-Glu_bd 101 164 6.6e-20 SMART
transmembrane domain 468 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of an N-methyl-D-aspartate (NMDA) receptor. The encoded protein is found primarily in motor neurons, where it forms a heterotetramer with GRIN1 to create an excitatory glycine receptor. Variations in this gene have been proposed to be linked to schizophrenia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele show a mild impairment in motor learning or coordination, reduced home cage activity, a highly increased social interaction with familiar cagemates in their home cage but moderately increased anxiety-like behavior and reduced social interaction in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Olfr716 T C 7: 107,147,711 Y132H probably damaging Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Grin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02754:Grin3b APN 10 79972889 missense possibly damaging 0.50
IGL03352:Grin3b APN 10 79973781 missense probably damaging 0.99
R0485:Grin3b UTSW 10 79974056 missense possibly damaging 0.68
R0927:Grin3b UTSW 10 79971228 missense probably benign 0.04
R1526:Grin3b UTSW 10 79974602 missense probably damaging 1.00
R1699:Grin3b UTSW 10 79975882 missense probably damaging 0.99
R1789:Grin3b UTSW 10 79973408 missense probably benign
R1916:Grin3b UTSW 10 79974598 missense probably damaging 1.00
R1991:Grin3b UTSW 10 79970912 missense probably benign
R1991:Grin3b UTSW 10 79974646 missense probably damaging 1.00
R4359:Grin3b UTSW 10 79972897 missense probably benign 0.00
R4817:Grin3b UTSW 10 79976898 missense probably benign 0.01
R4909:Grin3b UTSW 10 79977104 makesense probably null
R4942:Grin3b UTSW 10 79975722 missense probably damaging 0.99
R4981:Grin3b UTSW 10 79976357 intron probably benign
R5689:Grin3b UTSW 10 79974631 missense probably damaging 1.00
R5910:Grin3b UTSW 10 79973021 missense probably benign 0.00
R6132:Grin3b UTSW 10 79976440 missense probably damaging 1.00
R6242:Grin3b UTSW 10 79976179 missense probably damaging 1.00
R6336:Grin3b UTSW 10 79976461 missense probably damaging 1.00
R6942:Grin3b UTSW 10 79976119 critical splice donor site probably null
R7201:Grin3b UTSW 10 79974078 missense possibly damaging 0.96
R7322:Grin3b UTSW 10 79975695 missense probably damaging 1.00
R7526:Grin3b UTSW 10 79973051 missense probably benign
R7707:Grin3b UTSW 10 79975901 missense possibly damaging 0.89
R8069:Grin3b UTSW 10 79977034 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTGGCCTTTGACTTTGAG -3'
(R):5'- CAGTGCGTCCGAAGAGAATG -3'

Sequencing Primer
(F):5'- CGTGATGGACGCTGGACAG -3'
(R):5'- CGTCCGAAGAGAATGGCGTAG -3'
Posted On2018-03-15