Incidental Mutation 'R6263:Col3a1'
ID506791
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Namecollagen, type III, alpha 1
SynonymsCol3a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location45311538-45349706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45321575 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000085192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883]
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: V55A
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: V55A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189818
Meta Mutation Damage Score 0.1964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Kraken UTSW 1 45327866 splice site probably null
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5033:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 splice site probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
R7189:Col3a1 UTSW 1 45333657 missense unknown
R7194:Col3a1 UTSW 1 45331700 missense unknown
R7199:Col3a1 UTSW 1 45332141 missense probably null 0.99
R7204:Col3a1 UTSW 1 45322418 missense unknown
R7304:Col3a1 UTSW 1 45347811 missense unknown
R7378:Col3a1 UTSW 1 45327647 splice site probably null
R7398:Col3a1 UTSW 1 45327813 missense unknown
R7742:Col3a1 UTSW 1 45345001 missense unknown
R8072:Col3a1 UTSW 1 45321574 missense unknown
R8177:Col3a1 UTSW 1 45335764 missense unknown
R8183:Col3a1 UTSW 1 45334810 missense unknown
R8445:Col3a1 UTSW 1 45341180 nonsense probably null
R8490:Col3a1 UTSW 1 45345956 missense probably benign 0.01
R8546:Col3a1 UTSW 1 45340939 intron probably benign
R8720:Col3a1 UTSW 1 45347733 missense unknown
R8888:Col3a1 UTSW 1 45339979 missense unknown
Z1177:Col3a1 UTSW 1 45311800 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGCTGCATAAGTAATAGACAAG -3'
(R):5'- TGGCAACAGACATGGCTTGC -3'

Sequencing Primer
(F):5'- TGATGAAAAATTGCACTGTGCC -3'
(R):5'- GCAACAGACATGGCTTGCATTTC -3'
Posted On2018-03-15